Incidental Mutation 'R9288:Eml6'
ID 704095
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Name echinoderm microtubule associated protein like 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 29743048-30026033 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to G at 29838641 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
AlphaFold Q5SQM0
Predicted Effect probably null
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,618 D66G probably benign Het
Acot7 T A 4: 152,206,806 H76Q probably damaging Het
Acsf2 C T 11: 94,573,218 V47M probably benign Het
Agmat T C 4: 141,747,080 S91P probably damaging Het
Apba1 A G 19: 23,945,781 *843W probably null Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Asz1 A G 6: 18,051,369 I437T possibly damaging Het
Bbs12 C T 3: 37,320,563 L387F probably damaging Het
BC028528 T C 3: 95,891,915 I6V probably benign Het
C6 A C 15: 4,806,050 K770T Het
Cacna1g T A 11: 94,418,071 K1669* probably null Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cit C T 5: 115,985,453 T1436I probably damaging Het
Col14a1 T A 15: 55,423,522 V913E unknown Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Epb41l2 A G 10: 25,479,755 T486A possibly damaging Het
Fbln5 A T 12: 101,768,469 C181* probably null Het
Flnb A C 14: 7,904,498 D967A probably benign Het
Glyatl3 A G 17: 40,910,125 V117A probably benign Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gpa33 G A 1: 166,152,735 M122I probably benign Het
Gtf2ird2 A G 5: 134,192,732 E58G possibly damaging Het
Hdlbp T C 1: 93,409,051 E1125G probably benign Het
Hook1 C T 4: 96,013,268 R488C probably damaging Het
Isx G T 8: 74,892,811 A197S probably benign Het
Klhl10 G T 11: 100,456,893 A592S probably benign Het
Kmt2c A T 5: 25,292,909 D3949E probably damaging Het
Kmt2c A T 5: 25,349,862 I1258K probably benign Het
Lpin3 C A 2: 160,903,632 N618K probably damaging Het
Lrrc9 T A 12: 72,476,084 D701E probably benign Het
Mex3a T A 3: 88,536,151 M178K possibly damaging Het
Mex3b T C 7: 82,868,951 V158A probably benign Het
Myh7 A T 14: 54,985,475 F758I probably benign Het
Neb T G 2: 52,161,391 N6626H probably damaging Het
Nsmaf T C 4: 6,414,976 K630R probably benign Het
Obscn A T 11: 59,085,223 F2026Y probably benign Het
Osbpl1a A G 18: 12,771,345 L589P probably damaging Het
Pcsk5 T C 19: 17,836,981 K58E probably benign Het
Poll T C 19: 45,558,842 I64V probably benign Het
Prdm10 A G 9: 31,341,378 E469G possibly damaging Het
Ptprb T A 10: 116,319,448 N415K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rft1 A T 14: 30,661,458 K152* probably null Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Rnf180 GAG GAGTAG 13: 105,250,274 probably benign Het
Rnf180 AGG AGGGGG 13: 105,250,275 probably benign Het
Rnf180 GG GGACG 13: 105,250,276 probably benign Het
Rnf180 G GAGA 13: 105,250,277 probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sfpq T C 4: 127,022,834 S275P probably damaging Het
Sorl1 A G 9: 42,041,631 F705L probably damaging Het
Spata17 A G 1: 187,112,559 V281A possibly damaging Het
Sulf1 G A 1: 12,786,603 R26Q probably benign Het
Tbc1d4 T C 14: 101,454,872 Y1052C probably damaging Het
Tgfbr2 T C 9: 116,110,081 D251G probably benign Het
Tmem88b A T 4: 155,784,276 W172R probably damaging Het
Vdac2 C A 14: 21,831,894 P7T probably benign Het
Vmn2r112 A G 17: 22,603,342 K334E probably damaging Het
Vmn2r8 A T 5: 108,802,319 S221T probably benign Het
Zfp608 G T 18: 54,900,269 N397K probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
R7615:Eml6 UTSW 11 29802501 missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29753085 missense probably damaging 0.98
R7980:Eml6 UTSW 11 29833205 missense probably damaging 1.00
R8026:Eml6 UTSW 11 29749973 missense possibly damaging 0.63
R8046:Eml6 UTSW 11 29758981 missense probably damaging 0.99
R8049:Eml6 UTSW 11 29893201 missense possibly damaging 0.95
R8114:Eml6 UTSW 11 29754910 missense probably damaging 1.00
R8425:Eml6 UTSW 11 29755008 missense probably benign 0.00
R8799:Eml6 UTSW 11 29758981 missense probably benign 0.11
R8945:Eml6 UTSW 11 29753110 missense probably damaging 0.98
R8977:Eml6 UTSW 11 29784182 missense possibly damaging 0.59
R8986:Eml6 UTSW 11 29805181 missense possibly damaging 0.92
R9088:Eml6 UTSW 11 29818424 missense probably damaging 0.96
R9150:Eml6 UTSW 11 29805791 missense probably benign 0.15
R9209:Eml6 UTSW 11 29831175 missense probably damaging 1.00
R9467:Eml6 UTSW 11 29819076 missense probably damaging 0.99
RF037:Eml6 UTSW 11 29752549 critical splice acceptor site probably benign
RF039:Eml6 UTSW 11 29752551 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTTGACCAGTCCAAAATCATCTCC -3'
(R):5'- AAGGTCGAGGTATCAATAGTTTGAG -3'

Sequencing Primer
(F):5'- TCTCCAGAAACCAACACTGAACTG -3'
(R):5'- GAACTTGCAGTTCCTCTGAT -3'
Posted On 2022-03-25