Incidental Mutation 'R0755:Baiap2l1'
ID70411
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene NameBAI1-associated protein 2-like 1
SynonymsIRTKS, 1300006M19Rik
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0755 (G1)
Quality Score216
Status Not validated
Chromosome5
Chromosomal Location144264526-144358112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144284557 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 176 (K176E)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
PDB Structure
Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000055190
AA Change: K176E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: K176E

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129287
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198873
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Chrm4 T C 2: 91,928,402 V385A probably benign Het
Cntrl G A 2: 35,145,139 S373N probably damaging Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Cyb5r4 G T 9: 87,029,572 A100S probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc4a2 G A 5: 24,435,577 A652T probably benign Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Snx33 T C 9: 56,925,457 I443V possibly damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn1r33 A T 6: 66,611,908 S221T probably damaging Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144285546 nonsense probably null
IGL00789:Baiap2l1 APN 5 144286069 splice site probably null
IGL00922:Baiap2l1 APN 5 144318967 missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144275913 missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144280815 intron probably benign
IGL02748:Baiap2l1 APN 5 144266605 intron probably benign
IGL03348:Baiap2l1 APN 5 144278531 missense probably benign 0.08
PIT4382001:Baiap2l1 UTSW 5 144278670 missense possibly damaging 0.71
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144266010 missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144266641 missense probably benign 0.21
R0765:Baiap2l1 UTSW 5 144277703 missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144286133 missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144324555 critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144278535 missense possibly damaging 0.67
R4451:Baiap2l1 UTSW 5 144278552 missense probably damaging 1.00
R5093:Baiap2l1 UTSW 5 144278553 missense probably damaging 1.00
R5471:Baiap2l1 UTSW 5 144282141 missense probably benign 0.01
R5523:Baiap2l1 UTSW 5 144275958 missense probably damaging 1.00
R5524:Baiap2l1 UTSW 5 144280949 missense probably benign 0.01
R5586:Baiap2l1 UTSW 5 144282139 missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144265977 missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6353:Baiap2l1 UTSW 5 144282088 missense possibly damaging 0.80
R6572:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144286106 missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144285579 missense possibly damaging 0.94
R7218:Baiap2l1 UTSW 5 144275877 missense probably benign 0.01
R7352:Baiap2l1 UTSW 5 144324626 missense probably benign 0.03
R7662:Baiap2l1 UTSW 5 144357890 intron probably benign
R7797:Baiap2l1 UTSW 5 144318950 missense probably damaging 1.00
R7981:Baiap2l1 UTSW 5 144357890 intron probably benign
R8170:Baiap2l1 UTSW 5 144277692 nonsense probably null
R8308:Baiap2l1 UTSW 5 144277677 missense probably benign 0.06
R8333:Baiap2l1 UTSW 5 144280881 missense possibly damaging 0.89
X0022:Baiap2l1 UTSW 5 144278652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACCTGTGCTACTCTGTAAGG -3'
(R):5'- CTCTCAGGCCAGCTTACACGTATTC -3'

Sequencing Primer
(F):5'- CCTGTGCTACTCTGTAAGGAAAGG -3'
(R):5'- CAGCTTACACGTATTCTGTGC -3'
Posted On2013-09-30