Mutagenetix > Incidental Mutations

Incidental Mutation 'R0755:Thsd7a'

70412

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

038935-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0755 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12555369 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 172 (L172Q)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

Predicted Effect

probably benign
Transcript: ENSMUST00000046121
AA Change: L172Q

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: L172Q

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.2e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119443

SMART Domains

Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	14	70	9.98e-5	SMART
TSP1	77	161	3.14e0	SMART
TSP1	166	225	6.62e-1	SMART
Blast:TSP1	226	262	1e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: L172Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: L172Q

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: L172Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: L172Q

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,946,364	S1231P	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,181		probably benign	Het
Acin1	A	G	14: 54,651,835	M1T	probably null	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Aldh1a1	A	G	19: 20,617,994	M96V	probably benign	Het
Ankfn1	T	A	11: 89,392,087	M245L	probably benign	Het
Arhgap19	T	C	19: 41,781,175	K54E	probably damaging	Het
Atp1a2	T	C	1: 172,289,381	Q223R	probably benign	Het
Atp8a2	C	T	14: 60,009,881	V557I	possibly damaging	Het
AU041133	A	T	10: 82,150,890	K126*	probably null	Het
Axin1	T	A	17: 26,182,506	Y351N	possibly damaging	Het
Baiap2l1	T	C	5: 144,284,557	K176E	probably damaging	Het
Baz2a	C	T	10: 128,119,691	T848I	possibly damaging	Het
Bbs2	A	C	8: 94,082,080	V333G	probably benign	Het
BC051019	G	A	7: 109,716,095	Q318*	probably null	Het
Cdc37	C	T	9: 21,139,864	D362N	probably damaging	Het
Cep170	A	T	1: 176,755,753	V1020E	probably damaging	Het
Chrm4	T	C	2: 91,928,402	V385A	probably benign	Het
Cntrl	G	A	2: 35,145,139	S373N	probably damaging	Het
Col23a1	G	A	11: 51,576,879	G19D	probably damaging	Het
Cyb5r4	G	T	9: 87,029,572	A100S	probably damaging	Het
Dctn1	C	T	6: 83,189,077	P115S	probably damaging	Het
Dhrs2	C	T	14: 55,234,790	T46M	probably damaging	Het
Disp2	T	C	2: 118,789,762	F325S	probably benign	Het
Dnah11	T	G	12: 117,954,829	T3456P	possibly damaging	Het
Dnah11	C	A	12: 118,198,625	V70F	probably benign	Het
Duoxa1	T	A	2: 122,304,680	T195S	probably benign	Het
Eif2ak1	T	A	5: 143,884,924	F353I	possibly damaging	Het
Esam	A	G	9: 37,536,702	T211A	probably damaging	Het
Faf1	A	G	4: 109,961,839	N636S	probably benign	Het
Fbxo25	A	G	8: 13,935,219	Y305C	probably benign	Het
Fchsd1	C	T	18: 37,968,750		probably null	Het
Fdxacb1	T	A	9: 50,771,725	D329E	possibly damaging	Het
Gm4070	A	T	7: 105,896,685	F2387I	possibly damaging	Het
Hbq1b	A	T	11: 32,287,104		probably null	Het
Hmcn2	T	A	2: 31,453,160	V4566E	probably damaging	Het
Igkv6-29	G	A	6: 70,139,069	T5I	probably benign	Het
Itfg1	A	T	8: 85,726,205	D511E	possibly damaging	Het
Jmjd1c	C	T	10: 67,096,599		probably benign	Het
Kat6b	T	A	14: 21,637,593	M570K	probably damaging	Het
Kdm4d	T	A	9: 14,464,295	K89M	probably damaging	Het
Krt19	A	T	11: 100,142,139	D194E	possibly damaging	Het
Lamc1	A	T	1: 153,247,450	Y665N	possibly damaging	Het
Lct	A	T	1: 128,294,135	S1556T	possibly damaging	Het
Macf1	A	G	4: 123,369,926	L4924P	probably damaging	Het
Mef2c	G	A	13: 83,656,353		probably null	Het
Mff	G	A	1: 82,750,605		probably null	Het
Mycbp2	A	T	14: 103,174,794	L2581Q	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nos3	T	A	5: 24,367,297	L123M	probably damaging	Het
Ntn5	C	T	7: 45,686,528	P128S	probably benign	Het
Nudt9	T	C	5: 104,065,054	V331A	probably damaging	Het
Olfr131	A	T	17: 38,082,194	Y261*	probably null	Het
Olfr854	T	C	9: 19,567,119	I88M	possibly damaging	Het
Pcdh7	A	T	5: 57,720,322	K406N	possibly damaging	Het
Pkdrej	T	A	15: 85,816,135	I1867L	probably benign	Het
Plppr4	C	T	3: 117,322,670	G455R	possibly damaging	Het
Pramef6	A	G	4: 143,897,729	V66A	probably damaging	Het
Prkag2	G	C	5: 24,947,631	S158R	probably benign	Het
Ptprq	T	G	10: 107,582,539	T1659P	probably benign	Het
Rasl12	A	G	9: 65,410,959	K202E	probably benign	Het
Rb1	A	C	14: 73,197,213	*922G	probably null	Het
Rsf1	C	T	7: 97,579,967	P22S	probably damaging	Het
Scn1a	T	G	2: 66,321,035	T797P	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc22a7	T	G	17: 46,438,187	H68P	possibly damaging	Het
Slc4a2	G	A	5: 24,435,577	A652T	probably benign	Het
Slc5a1	T	A	5: 33,133,389	L106M	probably benign	Het
Slco1c1	C	T	6: 141,531,532	P19S	probably damaging	Het
Snx1	A	G	9: 66,098,456	F127S	probably damaging	Het
Snx31	A	T	15: 36,534,430	I199N	probably damaging	Het
Snx33	T	C	9: 56,925,457	I443V	possibly damaging	Het
Sptbn1	A	G	11: 30,139,016	F749L	probably damaging	Het
Stoml3	T	A	3: 53,498,138	Y53*	probably null	Het
Stxbp2	A	G	8: 3,642,019	T554A	probably benign	Het
Tal1	T	C	4: 115,068,376	I214T	probably damaging	Het
Tas2r137	T	A	6: 40,491,410	I58N	probably damaging	Het
Thap1	A	G	8: 26,158,473	Y8C	probably damaging	Het
Ube3c	T	A	5: 29,637,742	D735E	probably damaging	Het
Unc80	G	A	1: 66,504,923	D402N	probably damaging	Het
Upf1	G	T	8: 70,334,129	R902S	probably benign	Het
Urb1	A	G	16: 90,774,094	Y1276H	probably damaging	Het
Urb1	A	T	16: 90,779,138	F843L	probably benign	Het
Vmn1r198	C	T	13: 22,355,232	T296I	probably benign	Het
Vmn1r33	A	T	6: 66,611,908	S221T	probably damaging	Het
Vmn2r103	A	G	17: 19,773,568	D69G	probably benign	Het
Vmn2r14	T	G	5: 109,216,360	L563F	possibly damaging	Het
Vmn2r60	G	A	7: 42,195,445	G744D	probably damaging	Het
Vstm4	T	C	14: 32,892,644	V181A	probably damaging	Het
Wdr60	T	C	12: 116,211,792	I922V	probably benign	Het
Wdr72	G	A	9: 74,145,094	V136I	probably benign	Het
Zfp236	T	A	18: 82,620,332	N1388Y	probably damaging	Het
Zfp53	T	A	17: 21,508,577	F291I	probably damaging	Het
Zfp944	A	T	17: 22,339,908	H119Q	possibly damaging	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense

Predicted Primers

PCR Primer
(F):5'- GTTGGACTGGCACACCTGAAACTC -3'
(R):5'- TTTCAAGGTCTGTGACTGGCACAAG -3'

Sequencing Primer
(F):5'- ACCTGAAACTCGGTGAGGTTG -3'
(R):5'- CTGTGACTGGCACAAGGAATTG -3'

Posted On

2013-09-30