Incidental Mutation 'R9288:Apcdd1'
ID 704120
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9288 (G1)
Quality Score 213.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,813,618 D66G probably benign Het
Acot7 T A 4: 152,206,806 H76Q probably damaging Het
Acsf2 C T 11: 94,573,218 V47M probably benign Het
Agmat T C 4: 141,747,080 S91P probably damaging Het
Apba1 A G 19: 23,945,781 *843W probably null Het
Asz1 A G 6: 18,051,369 I437T possibly damaging Het
Bbs12 C T 3: 37,320,563 L387F probably damaging Het
BC028528 T C 3: 95,891,915 I6V probably benign Het
C6 A C 15: 4,806,050 K770T Het
Cacna1g T A 11: 94,418,071 K1669* probably null Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cit C T 5: 115,985,453 T1436I probably damaging Het
Col14a1 T A 15: 55,423,522 V913E unknown Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Eml6 T G 11: 29,838,641 probably null Het
Epb41l2 A G 10: 25,479,755 T486A possibly damaging Het
Fbln5 A T 12: 101,768,469 C181* probably null Het
Flnb A C 14: 7,904,498 D967A probably benign Het
Glyatl3 A G 17: 40,910,125 V117A probably benign Het
Gm4553 GCAGCCCCCACAGGAACTACAACCACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGA GCAGCCCCCACAGGA 7: 142,165,288 probably benign Het
Gpa33 G A 1: 166,152,735 M122I probably benign Het
Gtf2ird2 A G 5: 134,192,732 E58G possibly damaging Het
Hdlbp T C 1: 93,409,051 E1125G probably benign Het
Hook1 C T 4: 96,013,268 R488C probably damaging Het
Isx G T 8: 74,892,811 A197S probably benign Het
Klhl10 G T 11: 100,456,893 A592S probably benign Het
Kmt2c A T 5: 25,292,909 D3949E probably damaging Het
Kmt2c A T 5: 25,349,862 I1258K probably benign Het
Lpin3 C A 2: 160,903,632 N618K probably damaging Het
Lrrc9 T A 12: 72,476,084 D701E probably benign Het
Mex3a T A 3: 88,536,151 M178K possibly damaging Het
Mex3b T C 7: 82,868,951 V158A probably benign Het
Myh7 A T 14: 54,985,475 F758I probably benign Het
Neb T G 2: 52,161,391 N6626H probably damaging Het
Nsmaf T C 4: 6,414,976 K630R probably benign Het
Obscn A T 11: 59,085,223 F2026Y probably benign Het
Osbpl1a A G 18: 12,771,345 L589P probably damaging Het
Pcsk5 T C 19: 17,836,981 K58E probably benign Het
Poll T C 19: 45,558,842 I64V probably benign Het
Prdm10 A G 9: 31,341,378 E469G possibly damaging Het
Ptprb T A 10: 116,319,448 N415K probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rft1 A T 14: 30,661,458 K152* probably null Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Rnf180 GAG GAGTAG 13: 105,250,274 probably benign Het
Rnf180 AGG AGGGGG 13: 105,250,275 probably benign Het
Rnf180 GG GGACG 13: 105,250,276 probably benign Het
Rnf180 G GAGA 13: 105,250,277 probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sfpq T C 4: 127,022,834 S275P probably damaging Het
Sorl1 A G 9: 42,041,631 F705L probably damaging Het
Spata17 A G 1: 187,112,559 V281A possibly damaging Het
Sulf1 G A 1: 12,786,603 R26Q probably benign Het
Tbc1d4 T C 14: 101,454,872 Y1052C probably damaging Het
Tgfbr2 T C 9: 116,110,081 D251G probably benign Het
Tmem88b A T 4: 155,784,276 W172R probably damaging Het
Vdac2 C A 14: 21,831,894 P7T probably benign Het
Vmn2r112 A G 17: 22,603,342 K334E probably damaging Het
Vmn2r8 A T 5: 108,802,319 S221T probably benign Het
Zfp608 G T 18: 54,900,269 N397K probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- GTTCGCATCCTTCCAGAAAGAAC -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-03-25