Incidental Mutation 'R9289:Tmco5'
ID 704126
Institutional Source Beutler Lab
Gene Symbol Tmco5
Ensembl Gene ENSMUSG00000027355
Gene Name transmembrane and coiled-coil domains 5
Synonyms 1700095F04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 116878691-116892494 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 116880264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 22 (A22T)
Ref Sequence ENSEMBL: ENSMUSP00000028834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028834] [ENSMUST00000123598] [ENSMUST00000155470]
AlphaFold Q9D9D5
Predicted Effect probably benign
Transcript: ENSMUST00000028834
AA Change: A22T

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028834
Gene: ENSMUSG00000027355
AA Change: A22T

DomainStartEndE-ValueType
Pfam:TMCO5 28 302 6.6e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123598
AA Change: A22T

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115690
Gene: ENSMUSG00000027355
AA Change: A22T

DomainStartEndE-ValueType
Pfam:TMCO5 27 250 3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155470
AA Change: A22T

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122739
Gene: ENSMUSG00000027355
AA Change: A22T

DomainStartEndE-ValueType
Pfam:TMCO5 27 164 1.8e-47 PFAM
Pfam:TMCO5 161 226 1.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Tmco5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Tmco5 APN 2 116887300 missense probably damaging 1.00
IGL03302:Tmco5 APN 2 116892279 missense probably damaging 0.97
R0054:Tmco5 UTSW 2 116887287 missense probably damaging 0.98
R0054:Tmco5 UTSW 2 116887287 missense probably damaging 0.98
R0369:Tmco5 UTSW 2 116880788 splice site probably null
R0485:Tmco5 UTSW 2 116890107 missense probably benign 0.15
R0973:Tmco5 UTSW 2 116883218 missense probably benign 0.04
R0973:Tmco5 UTSW 2 116883218 missense probably benign 0.04
R0974:Tmco5 UTSW 2 116883218 missense probably benign 0.04
R1622:Tmco5 UTSW 2 116880315 missense probably benign 0.28
R1838:Tmco5 UTSW 2 116880879 missense probably damaging 1.00
R2060:Tmco5 UTSW 2 116892255 missense probably damaging 1.00
R3761:Tmco5 UTSW 2 116887306 splice site probably null
R4514:Tmco5 UTSW 2 116880314 missense probably damaging 1.00
R4911:Tmco5 UTSW 2 116892208 missense possibly damaging 0.92
R7373:Tmco5 UTSW 2 116886745 missense probably benign 0.09
R7682:Tmco5 UTSW 2 116886271 missense probably benign 0.35
R7752:Tmco5 UTSW 2 116892262 missense probably damaging 0.99
R8342:Tmco5 UTSW 2 116880253 missense probably damaging 1.00
R9568:Tmco5 UTSW 2 116880249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGATGGGTTGAGAATCACATTG -3'
(R):5'- ACTCCACATATTTCTGGCTGGG -3'

Sequencing Primer
(F):5'- TGGGTTGAGAATCACATTGTAGAG -3'
(R):5'- GGCTGGGAACTTCCATCATGAAC -3'
Posted On 2022-03-25