Incidental Mutation 'R9289:1700018F24Rik'
ID 704134
Institutional Source Beutler Lab
Gene Symbol 1700018F24Rik
Ensembl Gene ENSMUSG00000029620
Gene Name RIKEN cDNA 1700018F24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 145042990-145045681 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 145045523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 306 (T306I)
Ref Sequence ENSEMBL: ENSMUSP00000031624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031624] [ENSMUST00000151196]
AlphaFold B2RW27
Predicted Effect probably benign
Transcript: ENSMUST00000031624
AA Change: T306I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031624
Gene: ENSMUSG00000029620
AA Change: T306I

DomainStartEndE-ValueType
Pfam:RasGEF_N 62 153 2.9e-10 PFAM
low complexity region 166 186 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151196
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in 1700018F24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:1700018F24Rik APN 5 145043147 missense possibly damaging 0.83
IGL01751:1700018F24Rik APN 5 145043171 splice site probably null
IGL02928:1700018F24Rik APN 5 145043517 missense probably damaging 1.00
IGL03324:1700018F24Rik APN 5 145045451 missense probably benign 0.01
PIT4486001:1700018F24Rik UTSW 5 145044104 missense probably damaging 1.00
R0359:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0554:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0724:1700018F24Rik UTSW 5 145044763 missense probably benign 0.10
R1774:1700018F24Rik UTSW 5 145045541 missense probably damaging 0.99
R2041:1700018F24Rik UTSW 5 145045401 missense probably damaging 0.99
R4625:1700018F24Rik UTSW 5 145044883 missense possibly damaging 0.95
R5043:1700018F24Rik UTSW 5 145044100 nonsense probably null
R5610:1700018F24Rik UTSW 5 145045346 missense possibly damaging 0.92
R5712:1700018F24Rik UTSW 5 145044753 missense probably benign 0.32
R6163:1700018F24Rik UTSW 5 145045288 nonsense probably null
R6799:1700018F24Rik UTSW 5 145044814 missense probably damaging 1.00
R7174:1700018F24Rik UTSW 5 145044817 missense probably benign 0.27
R8127:1700018F24Rik UTSW 5 145043439 missense possibly damaging 0.93
R8688:1700018F24Rik UTSW 5 145045373 missense probably damaging 0.98
R8975:1700018F24Rik UTSW 5 145043382 missense probably damaging 0.97
R9473:1700018F24Rik UTSW 5 145044102 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGATCAAGCTCTGCCCAC -3'
(R):5'- AGAGATGCACTCCACAGGTAC -3'

Sequencing Primer
(F):5'- GCTCTGCCCACATCAACTTATAC -3'
(R):5'- CTCCACAGGTACACATGAGTAGATTG -3'
Posted On 2022-03-25