Incidental Mutation 'R9289:Plat'
ID 704144
Institutional Source Beutler Lab
Gene Symbol Plat
Ensembl Gene ENSMUSG00000031538
Gene Name plasminogen activator, tissue
Synonyms t-PA, D8Ertd2e, tPA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 22757727-22782844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22782084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 553 (I553T)
Ref Sequence ENSEMBL: ENSMUSP00000033941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033941]
AlphaFold P11214
Predicted Effect probably damaging
Transcript: ENSMUST00000033941
AA Change: I553T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: I553T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FN1 38 80 5.69e-15 SMART
EGF 82 117 4.92e-5 SMART
KR 122 207 3.77e-33 SMART
KR 211 296 4.39e-34 SMART
Tryp_SPc 308 553 6.59e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Plat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Plat APN 8 22776828 missense probably benign 0.00
IGL01918:Plat APN 8 22780437 missense possibly damaging 0.82
IGL01998:Plat APN 8 22767147 missense probably benign 0.31
IGL02978:Plat APN 8 22776819 missense probably damaging 1.00
R0829:Plat UTSW 8 22772257 missense probably damaging 1.00
R1065:Plat UTSW 8 22776863 missense probably damaging 0.99
R2316:Plat UTSW 8 22776865 missense probably benign 0.04
R4485:Plat UTSW 8 22772212 missense probably benign 0.01
R4873:Plat UTSW 8 22768450 missense probably benign 0.03
R4875:Plat UTSW 8 22768450 missense probably benign 0.03
R4924:Plat UTSW 8 22778253 missense probably damaging 1.00
R5051:Plat UTSW 8 22773672 missense probably benign 0.01
R5062:Plat UTSW 8 22772311 missense probably benign 0.19
R5402:Plat UTSW 8 22772722 missense probably damaging 1.00
R5672:Plat UTSW 8 22773648 missense probably benign 0.40
R6306:Plat UTSW 8 22772266 missense possibly damaging 0.83
R7035:Plat UTSW 8 22772311 missense probably benign 0.32
R7154:Plat UTSW 8 22778505 missense possibly damaging 0.76
R7297:Plat UTSW 8 22775697 missense probably benign 0.12
R7432:Plat UTSW 8 22773651 missense probably damaging 0.99
R7514:Plat UTSW 8 22775642 missense probably damaging 1.00
R7679:Plat UTSW 8 22772232 missense probably damaging 1.00
R7680:Plat UTSW 8 22772232 missense probably damaging 1.00
R7742:Plat UTSW 8 22772232 missense probably damaging 1.00
R7834:Plat UTSW 8 22772232 missense probably damaging 1.00
R7885:Plat UTSW 8 22771720 missense probably benign 0.00
R7918:Plat UTSW 8 22773639 missense probably damaging 1.00
R8039:Plat UTSW 8 22772232 missense probably damaging 1.00
R8040:Plat UTSW 8 22772232 missense probably damaging 1.00
R8243:Plat UTSW 8 22772232 missense probably damaging 1.00
R8347:Plat UTSW 8 22772232 missense probably damaging 1.00
R8355:Plat UTSW 8 22771742 nonsense probably null
R8422:Plat UTSW 8 22772232 missense probably damaging 1.00
R8423:Plat UTSW 8 22772232 missense probably damaging 1.00
R8424:Plat UTSW 8 22772232 missense probably damaging 1.00
R8426:Plat UTSW 8 22772232 missense probably damaging 1.00
R8427:Plat UTSW 8 22772232 missense probably damaging 1.00
R8485:Plat UTSW 8 22772232 missense probably damaging 1.00
R8507:Plat UTSW 8 22772232 missense probably damaging 1.00
R8510:Plat UTSW 8 22772232 missense probably damaging 1.00
R8714:Plat UTSW 8 22772232 missense probably damaging 1.00
R8716:Plat UTSW 8 22772232 missense probably damaging 1.00
R8717:Plat UTSW 8 22772232 missense probably damaging 1.00
R9140:Plat UTSW 8 22780546 missense probably damaging 1.00
R9148:Plat UTSW 8 22778450 missense probably damaging 0.99
R9328:Plat UTSW 8 22778117 missense probably damaging 1.00
R9378:Plat UTSW 8 22775583 missense probably damaging 1.00
R9557:Plat UTSW 8 22772653 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTGCAGTCACCAAAGTAC -3'
(R):5'- AATGCTACATCTGCTCCCAAAG -3'

Sequencing Primer
(F):5'- TTCCAAATAGTCTGCCACGCG -3'
(R):5'- TCTGCTCCCAAAGACCCC -3'
Posted On 2022-03-25