Incidental Mutation 'R9289:Rnf150'
ID 704145
Institutional Source Beutler Lab
Gene Symbol Rnf150
Ensembl Gene ENSMUSG00000047747
Gene Name ring finger protein 150
Synonyms Greul5, A630007N06Rik, C030044C12Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 82863356-83091268 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82990353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 163 (E163G)
Ref Sequence ENSEMBL: ENSMUSP00000077610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078525]
AlphaFold Q5DTZ6
Predicted Effect probably benign
Transcript: ENSMUST00000078525
AA Change: E163G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077610
Gene: ENSMUSG00000047747
AA Change: E163G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
Pfam:PA 84 180 2.1e-12 PFAM
transmembrane domain 207 229 N/A INTRINSIC
RING 277 317 1.29e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dgcr8 C T 16: 18,280,215 probably benign Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Rnf150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Rnf150 APN 8 83003605 missense probably damaging 0.96
R0512:Rnf150 UTSW 8 82864178 missense probably benign 0.01
R1848:Rnf150 UTSW 8 82864010 start codon destroyed possibly damaging 0.67
R2078:Rnf150 UTSW 8 83003605 missense probably damaging 0.96
R2192:Rnf150 UTSW 8 82864391 missense probably damaging 0.98
R3918:Rnf150 UTSW 8 82864461 missense probably benign 0.25
R4365:Rnf150 UTSW 8 82864115 missense probably benign 0.05
R4781:Rnf150 UTSW 8 82864152 missense probably damaging 1.00
R4810:Rnf150 UTSW 8 82990362 missense possibly damaging 0.66
R4859:Rnf150 UTSW 8 82864083 missense probably damaging 1.00
R5677:Rnf150 UTSW 8 83003599 nonsense probably null
R6022:Rnf150 UTSW 8 83042729 missense probably benign 0.00
R6241:Rnf150 UTSW 8 82864464 missense possibly damaging 0.82
R6283:Rnf150 UTSW 8 82990554 missense probably damaging 1.00
R6306:Rnf150 UTSW 8 83083502 missense possibly damaging 0.90
R7014:Rnf150 UTSW 8 83042663 missense probably benign
R7023:Rnf150 UTSW 8 82864077 missense probably damaging 0.97
R7394:Rnf150 UTSW 8 82990471 nonsense probably null
R7710:Rnf150 UTSW 8 82864152 missense probably damaging 1.00
R7771:Rnf150 UTSW 8 82864203 missense probably benign 0.00
R8073:Rnf150 UTSW 8 82863917 start gained probably benign
R8856:Rnf150 UTSW 8 83036086 missense probably damaging 1.00
R8980:Rnf150 UTSW 8 82990458 missense probably benign 0.19
R9139:Rnf150 UTSW 8 82863959 start gained probably benign
R9410:Rnf150 UTSW 8 83036093 missense possibly damaging 0.91
R9594:Rnf150 UTSW 8 82990515 missense probably damaging 1.00
R9603:Rnf150 UTSW 8 82990579 missense possibly damaging 0.64
R9763:Rnf150 UTSW 8 83006339 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCACAAAGTGACCTTTAATCCTC -3'
(R):5'- GCCATGCCAGAGAAATGATCATC -3'

Sequencing Primer
(F):5'- AGTGACCTTTAATCCTCAAGACC -3'
(R):5'- CATGCCAGAGAAATGATCATCAGGAC -3'
Posted On 2022-03-25