Incidental Mutation 'R9289:Dhx30'
ID 704149
Institutional Source Beutler Lab
Gene Symbol Dhx30
Ensembl Gene ENSMUSG00000032480
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 30
Synonyms Ddx30, 2810477H02Rik, C130058C04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110084320-110117830 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110093121 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 164 (D164E)
Ref Sequence ENSEMBL: ENSMUSP00000062622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062368] [ENSMUST00000111991] [ENSMUST00000165596] [ENSMUST00000196171] [ENSMUST00000196455] [ENSMUST00000197928] [ENSMUST00000198425] [ENSMUST00000198443] [ENSMUST00000199529] [ENSMUST00000199835] [ENSMUST00000200066]
AlphaFold Q99PU8
Predicted Effect probably benign
Transcript: ENSMUST00000062368
AA Change: D164E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062622
Gene: ENSMUSG00000032480
AA Change: D164E

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
internal_repeat_1 76 123 2.53e-5 PROSPERO
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 268 314 2.53e-5 PROSPERO
low complexity region 321 342 N/A INTRINSIC
DEXDc 461 650 9.66e-29 SMART
low complexity region 679 689 N/A INTRINSIC
HELICc 711 816 1.63e-17 SMART
HA2 879 969 5.16e-22 SMART
Pfam:OB_NTP_bind 984 1134 5.7e-9 PFAM
low complexity region 1200 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111991
AA Change: D135E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107622
Gene: ENSMUSG00000032480
AA Change: D135E

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165596
AA Change: D158E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129174
Gene: ENSMUSG00000032480
AA Change: D158E

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196171
AA Change: D127E

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143616
Gene: ENSMUSG00000032480
AA Change: D127E

DomainStartEndE-ValueType
internal_repeat_1 39 86 5.84e-5 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 231 277 5.84e-5 PROSPERO
low complexity region 284 305 N/A INTRINSIC
DEXDc 424 613 9.66e-29 SMART
low complexity region 642 652 N/A INTRINSIC
HELICc 674 779 1.63e-17 SMART
HA2 842 932 5.16e-22 SMART
Pfam:OB_NTP_bind 947 1097 2.8e-9 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196455
AA Change: D131E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143751
Gene: ENSMUSG00000032480
AA Change: D131E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
PDB:2DB2|A 77 113 3e-19 PDB
low complexity region 114 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197928
AA Change: D135E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142549
Gene: ENSMUSG00000032480
AA Change: D135E

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198425
AA Change: D158E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142659
Gene: ENSMUSG00000032480
AA Change: D158E

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198443
SMART Domains Protein: ENSMUSP00000142836
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199529
AA Change: D135E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142489
Gene: ENSMUSG00000032480
AA Change: D135E

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199835
AA Change: D158E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142636
Gene: ENSMUSG00000032480
AA Change: D158E

DomainStartEndE-ValueType
PDB:2DB2|A 67 171 3e-68 PDB
SCOP:d1di2a_ 76 145 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200066
AA Change: D135E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143371
Gene: ENSMUSG00000032480
AA Change: D135E

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The family member encoded by this gene is a mitochondrial nucleoid protein that associates with mitochondrial DNA. It has also been identified as a component of a transcriptional repressor complex that functions in retinal development, and it is required to optimize the function of the zinc-finger antiviral protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with embryonic growth retardation, failure of initiation of embryo turning, and absence of organized somites and neural tube formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Dhx30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Dhx30 APN 9 110086245 missense probably benign 0.01
IGL01800:Dhx30 APN 9 110085513 missense possibly damaging 0.92
IGL02403:Dhx30 APN 9 110091519 missense probably damaging 1.00
IGL02869:Dhx30 APN 9 110097183 missense probably damaging 1.00
IGL03177:Dhx30 APN 9 110088010 missense possibly damaging 0.75
R0092:Dhx30 UTSW 9 110085010 missense possibly damaging 0.94
R0601:Dhx30 UTSW 9 110086714 splice site probably null
R1667:Dhx30 UTSW 9 110085445 missense possibly damaging 0.91
R1667:Dhx30 UTSW 9 110085446 missense possibly damaging 0.48
R1670:Dhx30 UTSW 9 110085273 missense possibly damaging 0.86
R1728:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1729:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1795:Dhx30 UTSW 9 110107983 splice site probably null
R1854:Dhx30 UTSW 9 110088672 missense probably damaging 1.00
R2191:Dhx30 UTSW 9 110086118 critical splice donor site probably null
R2219:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2220:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2267:Dhx30 UTSW 9 110087034 missense probably damaging 1.00
R2374:Dhx30 UTSW 9 110091564 missense probably damaging 0.98
R2568:Dhx30 UTSW 9 110097195 missense probably damaging 0.99
R2881:Dhx30 UTSW 9 110098845 nonsense probably null
R4022:Dhx30 UTSW 9 110084397 missense possibly damaging 0.90
R4052:Dhx30 UTSW 9 110100821 missense possibly damaging 0.46
R4695:Dhx30 UTSW 9 110085288 missense probably damaging 0.98
R4728:Dhx30 UTSW 9 110087650 missense probably damaging 1.00
R4892:Dhx30 UTSW 9 110085856 splice site probably null
R4911:Dhx30 UTSW 9 110100924 missense probably damaging 1.00
R4937:Dhx30 UTSW 9 110085961 missense probably damaging 1.00
R5135:Dhx30 UTSW 9 110098795 missense probably damaging 1.00
R5359:Dhx30 UTSW 9 110093135 missense probably damaging 0.99
R5462:Dhx30 UTSW 9 110100974 missense probably damaging 0.97
R5504:Dhx30 UTSW 9 110085210 missense probably benign 0.08
R5797:Dhx30 UTSW 9 110098820 missense probably damaging 0.99
R5860:Dhx30 UTSW 9 110084577 missense probably damaging 0.98
R6041:Dhx30 UTSW 9 110084598 missense probably benign 0.09
R6132:Dhx30 UTSW 9 110085779 missense probably damaging 1.00
R6158:Dhx30 UTSW 9 110087030 missense probably damaging 1.00
R6475:Dhx30 UTSW 9 110085052 missense possibly damaging 0.91
R6818:Dhx30 UTSW 9 110088031 missense probably damaging 1.00
R6984:Dhx30 UTSW 9 110091417 critical splice donor site probably null
R7412:Dhx30 UTSW 9 110092898 missense probably benign
R7477:Dhx30 UTSW 9 110087140 missense probably damaging 1.00
R7808:Dhx30 UTSW 9 110086202 missense probably benign 0.00
R7982:Dhx30 UTSW 9 110085456 missense probably damaging 1.00
R8343:Dhx30 UTSW 9 110085501 missense possibly damaging 0.95
R8376:Dhx30 UTSW 9 110088639 missense probably benign 0.15
R8434:Dhx30 UTSW 9 110100906 missense probably benign
R8831:Dhx30 UTSW 9 110088251 missense probably benign 0.01
R8842:Dhx30 UTSW 9 110085228 missense probably benign 0.33
R8971:Dhx30 UTSW 9 110084445 nonsense probably null
R9001:Dhx30 UTSW 9 110087555 missense probably damaging 0.99
R9117:Dhx30 UTSW 9 110097096 missense probably damaging 0.99
R9177:Dhx30 UTSW 9 110086682 missense probably damaging 0.97
R9189:Dhx30 UTSW 9 110085426 nonsense probably null
R9281:Dhx30 UTSW 9 110100915 missense probably benign 0.01
R9289:Dhx30 UTSW 9 110091535 missense possibly damaging 0.66
R9424:Dhx30 UTSW 9 110087644 missense probably damaging 1.00
R9576:Dhx30 UTSW 9 110087644 missense probably damaging 1.00
R9599:Dhx30 UTSW 9 110085450 missense possibly damaging 0.75
X0027:Dhx30 UTSW 9 110084434 missense possibly damaging 0.87
Z1176:Dhx30 UTSW 9 110086965 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTCACATCAATGGTCCCC -3'
(R):5'- TCAGGCCCGCTTGCTTAG -3'

Sequencing Primer
(F):5'- ACATCAATGGTCCCCTCTTCTAG -3'
(R):5'- TGGCCTGGATCACAAGATTC -3'
Posted On 2022-03-25