Incidental Mutation 'R0755:Vmn1r33'
Institutional Source Beutler Lab
Gene Symbol Vmn1r33
Ensembl Gene ENSMUSG00000059375
Gene Namevomeronasal 1 receptor 33
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0755 (G1)
Quality Score225
Status Not validated
Chromosomal Location66610543-66618282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66611908 bp
Amino Acid Change Serine to Threonine at position 221 (S221T)
Ref Sequence ENSEMBL: ENSMUSP00000153840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079678] [ENSMUST00000227418]
Predicted Effect probably damaging
Transcript: ENSMUST00000079678
AA Change: S221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078619
Gene: ENSMUSG00000059375
AA Change: S221T

Pfam:V1R 28 293 2e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175988
AA Change: S221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134913
Gene: ENSMUSG00000059375
AA Change: S221T

Pfam:V1R 28 293 2e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227418
AA Change: S221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baiap2l1 T C 5: 144,284,557 K176E probably damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Chrm4 T C 2: 91,928,402 V385A probably benign Het
Cntrl G A 2: 35,145,139 S373N probably damaging Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Cyb5r4 G T 9: 87,029,572 A100S probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc4a2 G A 5: 24,435,577 A652T probably benign Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Snx33 T C 9: 56,925,457 I443V possibly damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Vmn1r33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Vmn1r33 APN 6 66611881 missense probably damaging 1.00
R0008:Vmn1r33 UTSW 6 66612526 nonsense probably null
R0624:Vmn1r33 UTSW 6 66612137 nonsense probably null
R0639:Vmn1r33 UTSW 6 66611799 missense probably damaging 1.00
R0673:Vmn1r33 UTSW 6 66611799 missense probably damaging 1.00
R1756:Vmn1r33 UTSW 6 66612298 missense possibly damaging 0.94
R2015:Vmn1r33 UTSW 6 66612372 missense probably benign 0.00
R2059:Vmn1r33 UTSW 6 66612202 missense probably benign 0.00
R2443:Vmn1r33 UTSW 6 66611973 missense possibly damaging 0.70
R3837:Vmn1r33 UTSW 6 66611717 missense possibly damaging 0.58
R4732:Vmn1r33 UTSW 6 66611819 missense probably benign 0.00
R4733:Vmn1r33 UTSW 6 66611819 missense probably benign 0.00
R5023:Vmn1r33 UTSW 6 66612105 missense probably benign 0.03
R5057:Vmn1r33 UTSW 6 66612105 missense probably benign 0.03
R5769:Vmn1r33 UTSW 6 66611833 missense possibly damaging 0.60
R5790:Vmn1r33 UTSW 6 66612214 missense probably benign 0.00
R7739:Vmn1r33 UTSW 6 66612373 missense probably benign 0.22
R8064:Vmn1r33 UTSW 6 66611927 missense probably benign 0.35
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgggaattgaaaactgaaataaacac -3'
Posted On2013-09-30