Incidental Mutation 'R9289:Glb1'
ID 704150
Institutional Source Beutler Lab
Gene Symbol Glb1
Ensembl Gene ENSMUSG00000045594
Gene Name galactosidase, beta 1
Synonyms C130097A14Rik, Bgs, Bgl-t, Bgl, Bgl-e, Bgt, Bge, Bgl-s
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 114401076-114474898 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114420490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 129 (A129E)
Ref Sequence ENSEMBL: ENSMUSP00000055803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000217583]
AlphaFold P23780
Predicted Effect probably damaging
Transcript: ENSMUST00000063042
AA Change: A129E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594
AA Change: A129E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217583
AA Change: A47E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a lysosomal enzyme that catalyzes the hydrolysis of terminal beta-D-galactose residues in various substrates like lactose, ganglioside GM1 and other glycoproteins. Mutations in the human gene are associated with GM1-gangliosidosis and Morquio B syndrome. Disruption of the mouse gene mirrors the symptoms of human gangliosidosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit progressive spastic diplegia, emaciation, and accumulation of ganglioside GM1 and asialo GM1 in brain tissue. Mutants die at 7-10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Glb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Glb1 APN 9 114450677 splice site probably benign
IGL01649:Glb1 APN 9 114423948 missense probably damaging 1.00
IGL01720:Glb1 APN 9 114420505 critical splice donor site probably null
IGL02199:Glb1 APN 9 114473947 missense probably benign 0.06
IGL02613:Glb1 APN 9 114464062 missense possibly damaging 0.91
IGL03392:Glb1 APN 9 114430321 missense probably damaging 1.00
R0463:Glb1 UTSW 9 114421744 frame shift probably null
R0518:Glb1 UTSW 9 114421744 frame shift probably null
R0519:Glb1 UTSW 9 114421744 frame shift probably null
R0520:Glb1 UTSW 9 114421744 frame shift probably null
R1387:Glb1 UTSW 9 114420363 missense probably damaging 1.00
R1499:Glb1 UTSW 9 114417103 missense probably benign 0.04
R1898:Glb1 UTSW 9 114424035 missense probably damaging 1.00
R2143:Glb1 UTSW 9 114437824 missense probably damaging 1.00
R2145:Glb1 UTSW 9 114464165 missense probably benign 0.00
R2146:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2148:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2149:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2150:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2170:Glb1 UTSW 9 114473805 critical splice acceptor site probably benign
R2259:Glb1 UTSW 9 114443032 nonsense probably null
R2401:Glb1 UTSW 9 114454257 missense possibly damaging 0.81
R3980:Glb1 UTSW 9 114417064 missense probably damaging 0.97
R4488:Glb1 UTSW 9 114443114 missense probably damaging 1.00
R4696:Glb1 UTSW 9 114464152 missense probably benign
R5349:Glb1 UTSW 9 114434461 critical splice donor site probably null
R6045:Glb1 UTSW 9 114437942 missense probably damaging 1.00
R6448:Glb1 UTSW 9 114434431 missense probably damaging 0.99
R7308:Glb1 UTSW 9 114473863 missense probably damaging 0.98
R7327:Glb1 UTSW 9 114417058 missense probably benign 0.00
R7492:Glb1 UTSW 9 114473949 missense probably damaging 1.00
R8087:Glb1 UTSW 9 114430415 missense probably damaging 1.00
R8181:Glb1 UTSW 9 114430361 missense probably damaging 1.00
R9067:Glb1 UTSW 9 114473854 missense probably damaging 0.99
R9187:Glb1 UTSW 9 114473923 missense probably damaging 1.00
R9315:Glb1 UTSW 9 114456480 missense probably benign
X0052:Glb1 UTSW 9 114473805 critical splice acceptor site probably benign
Z1177:Glb1 UTSW 9 114420422 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAGGTGTCAAATGCTCACAG -3'
(R):5'- AATAAACACTGGCGGGTCAC -3'

Sequencing Primer
(F):5'- CGTTCAGCTGCCACCTG -3'
(R):5'- GGGTCACAGTACCACTTGCTCTAG -3'
Posted On 2022-03-25