Mutagenetix > Incidental Mutations

Incidental Mutation 'R0755:Dctn1'

70416

Institutional Source

Beutler Lab

Gene Symbol

Dctn1

Ensembl Gene

ENSMUSG00000031865

Gene Name

dynactin 1

Synonyms

p150, Glued, p150

MMRRC Submission

038935-MU

Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0755 (G1)

Quality Score

128

Status

Not validated

Chromosome

Chromosomal Location

83165920-83200117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83189077 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 115 (P115S)

Ref Sequence

ENSEMBL: ENSMUSP00000076623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919] [ENSMUST00000130212] [ENSMUST00000141680]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077407
AA Change: P115S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: P115S

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC
SCOP:d1fxkc_	185	337	3e-3	SMART
low complexity region	363	379	N/A	INTRINSIC
Pfam:Dynactin	489	768	8.2e-91	PFAM
low complexity region	800	820	N/A	INTRINSIC
coiled coil region	914	1009	N/A	INTRINSIC
low complexity region	1025	1043	N/A	INTRINSIC
coiled coil region	1143	1172	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113907
AA Change: P18S

SMART Domains

Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: P18S

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
low complexity region	27	50	N/A	INTRINSIC
low complexity region	51	80	N/A	INTRINSIC
low complexity region	93	106	N/A	INTRINSIC
low complexity region	140	158	N/A	INTRINSIC
SCOP:d1lxa__	271	345	8e-3	SMART
Pfam:Dynactin	392	671	7.1e-91	PFAM
low complexity region	703	723	N/A	INTRINSIC
coiled coil region	817	912	N/A	INTRINSIC
low complexity region	928	946	N/A	INTRINSIC
coiled coil region	1046	1075	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113913
AA Change: P135S

SMART Domains

Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: P135S

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	167	N/A	INTRINSIC
low complexity region	168	197	N/A	INTRINSIC
SCOP:d1fxkc_	205	357	3e-3	SMART
low complexity region	383	399	N/A	INTRINSIC
Pfam:Dynactin	509	788	2.5e-90	PFAM
low complexity region	820	840	N/A	INTRINSIC
coiled coil region	934	1029	N/A	INTRINSIC
low complexity region	1051	1069	N/A	INTRINSIC
coiled coil region	1168	1197	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113918
AA Change: P152S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: P152S

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
low complexity region	227	240	N/A	INTRINSIC
low complexity region	274	292	N/A	INTRINSIC
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	526	805	3.3e-90	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
coiled coil region	1147	1176	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113919
AA Change: P152S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: P152S

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
SCOP:d1fxkc_	222	374	3e-3	SMART
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	522	805	1.4e-103	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
low complexity region	1068	1086	N/A	INTRINSIC
coiled coil region	1185	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123313

Predicted Effect

probably benign
Transcript: ENSMUST00000130212
AA Change: P115S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865
AA Change: P115S

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000141680
AA Change: P135S

SMART Domains

Protein: ENSMUSP00000121538
Gene: ENSMUSG00000031865
AA Change: P135S

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	159	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,946,364	S1231P	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,181		probably benign	Het
Acin1	A	G	14: 54,651,835	M1T	probably null	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Aldh1a1	A	G	19: 20,617,994	M96V	probably benign	Het
Ankfn1	T	A	11: 89,392,087	M245L	probably benign	Het
Arhgap19	T	C	19: 41,781,175	K54E	probably damaging	Het
Atp1a2	T	C	1: 172,289,381	Q223R	probably benign	Het
Atp8a2	C	T	14: 60,009,881	V557I	possibly damaging	Het
AU041133	A	T	10: 82,150,890	K126*	probably null	Het
Axin1	T	A	17: 26,182,506	Y351N	possibly damaging	Het
Baiap2l1	T	C	5: 144,284,557	K176E	probably damaging	Het
Baz2a	C	T	10: 128,119,691	T848I	possibly damaging	Het
Bbs2	A	C	8: 94,082,080	V333G	probably benign	Het
BC051019	G	A	7: 109,716,095	Q318*	probably null	Het
Cdc37	C	T	9: 21,139,864	D362N	probably damaging	Het
Cep170	A	T	1: 176,755,753	V1020E	probably damaging	Het
Chrm4	T	C	2: 91,928,402	V385A	probably benign	Het
Cntrl	G	A	2: 35,145,139	S373N	probably damaging	Het
Col23a1	G	A	11: 51,576,879	G19D	probably damaging	Het
Cyb5r4	G	T	9: 87,029,572	A100S	probably damaging	Het
Dhrs2	C	T	14: 55,234,790	T46M	probably damaging	Het
Disp2	T	C	2: 118,789,762	F325S	probably benign	Het
Dnah11	T	G	12: 117,954,829	T3456P	possibly damaging	Het
Dnah11	C	A	12: 118,198,625	V70F	probably benign	Het
Duoxa1	T	A	2: 122,304,680	T195S	probably benign	Het
Eif2ak1	T	A	5: 143,884,924	F353I	possibly damaging	Het
Esam	A	G	9: 37,536,702	T211A	probably damaging	Het
Faf1	A	G	4: 109,961,839	N636S	probably benign	Het
Fbxo25	A	G	8: 13,935,219	Y305C	probably benign	Het
Fchsd1	C	T	18: 37,968,750		probably null	Het
Fdxacb1	T	A	9: 50,771,725	D329E	possibly damaging	Het
Gm4070	A	T	7: 105,896,685	F2387I	possibly damaging	Het
Hbq1b	A	T	11: 32,287,104		probably null	Het
Hmcn2	T	A	2: 31,453,160	V4566E	probably damaging	Het
Igkv6-29	G	A	6: 70,139,069	T5I	probably benign	Het
Itfg1	A	T	8: 85,726,205	D511E	possibly damaging	Het
Jmjd1c	C	T	10: 67,096,599		probably benign	Het
Kat6b	T	A	14: 21,637,593	M570K	probably damaging	Het
Kdm4d	T	A	9: 14,464,295	K89M	probably damaging	Het
Krt19	A	T	11: 100,142,139	D194E	possibly damaging	Het
Lamc1	A	T	1: 153,247,450	Y665N	possibly damaging	Het
Lct	A	T	1: 128,294,135	S1556T	possibly damaging	Het
Macf1	A	G	4: 123,369,926	L4924P	probably damaging	Het
Mef2c	G	A	13: 83,656,353		probably null	Het
Mff	G	A	1: 82,750,605		probably null	Het
Mycbp2	A	T	14: 103,174,794	L2581Q	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nos3	T	A	5: 24,367,297	L123M	probably damaging	Het
Ntn5	C	T	7: 45,686,528	P128S	probably benign	Het
Nudt9	T	C	5: 104,065,054	V331A	probably damaging	Het
Olfr131	A	T	17: 38,082,194	Y261*	probably null	Het
Olfr854	T	C	9: 19,567,119	I88M	possibly damaging	Het
Pcdh7	A	T	5: 57,720,322	K406N	possibly damaging	Het
Pkdrej	T	A	15: 85,816,135	I1867L	probably benign	Het
Plppr4	C	T	3: 117,322,670	G455R	possibly damaging	Het
Pramef6	A	G	4: 143,897,729	V66A	probably damaging	Het
Prkag2	G	C	5: 24,947,631	S158R	probably benign	Het
Ptprq	T	G	10: 107,582,539	T1659P	probably benign	Het
Rasl12	A	G	9: 65,410,959	K202E	probably benign	Het
Rb1	A	C	14: 73,197,213	*922G	probably null	Het
Rsf1	C	T	7: 97,579,967	P22S	probably damaging	Het
Scn1a	T	G	2: 66,321,035	T797P	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc22a7	T	G	17: 46,438,187	H68P	possibly damaging	Het
Slc4a2	G	A	5: 24,435,577	A652T	probably benign	Het
Slc5a1	T	A	5: 33,133,389	L106M	probably benign	Het
Slco1c1	C	T	6: 141,531,532	P19S	probably damaging	Het
Snx1	A	G	9: 66,098,456	F127S	probably damaging	Het
Snx31	A	T	15: 36,534,430	I199N	probably damaging	Het
Snx33	T	C	9: 56,925,457	I443V	possibly damaging	Het
Sptbn1	A	G	11: 30,139,016	F749L	probably damaging	Het
Stoml3	T	A	3: 53,498,138	Y53*	probably null	Het
Stxbp2	A	G	8: 3,642,019	T554A	probably benign	Het
Tal1	T	C	4: 115,068,376	I214T	probably damaging	Het
Tas2r137	T	A	6: 40,491,410	I58N	probably damaging	Het
Thap1	A	G	8: 26,158,473	Y8C	probably damaging	Het
Thsd7a	A	T	6: 12,555,369	L172Q	probably damaging	Het
Ube3c	T	A	5: 29,637,742	D735E	probably damaging	Het
Unc80	G	A	1: 66,504,923	D402N	probably damaging	Het
Upf1	G	T	8: 70,334,129	R902S	probably benign	Het
Urb1	A	G	16: 90,774,094	Y1276H	probably damaging	Het
Urb1	A	T	16: 90,779,138	F843L	probably benign	Het
Vmn1r198	C	T	13: 22,355,232	T296I	probably benign	Het
Vmn1r33	A	T	6: 66,611,908	S221T	probably damaging	Het
Vmn2r103	A	G	17: 19,773,568	D69G	probably benign	Het
Vmn2r14	T	G	5: 109,216,360	L563F	possibly damaging	Het
Vmn2r60	G	A	7: 42,195,445	G744D	probably damaging	Het
Vstm4	T	C	14: 32,892,644	V181A	probably damaging	Het
Wdr60	T	C	12: 116,211,792	I922V	probably benign	Het
Wdr72	G	A	9: 74,145,094	V136I	probably benign	Het
Zfp236	T	A	18: 82,620,332	N1388Y	probably damaging	Het
Zfp53	T	A	17: 21,508,577	F291I	probably damaging	Het
Zfp944	A	T	17: 22,339,908	H119Q	possibly damaging	Het

Other mutations in Dctn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Dctn1	APN	6	83179897	missense	probably benign	0.00
IGL01450:Dctn1	APN	6	83194110	unclassified	probably benign
IGL01876:Dctn1	APN	6	83197921	missense	probably damaging	1.00
IGL01958:Dctn1	APN	6	83191344	missense	possibly damaging	0.95
IGL02554:Dctn1	APN	6	83182722	missense	probably damaging	1.00
IGL02668:Dctn1	APN	6	83191048	missense	possibly damaging	0.89
IGL02814:Dctn1	APN	6	83189914	missense	probably damaging	1.00
IGL02818:Dctn1	APN	6	83192514	missense	possibly damaging	0.86
IGL03007:Dctn1	APN	6	83182708	missense	probably damaging	1.00
IGL03065:Dctn1	APN	6	83192493	missense	probably damaging	0.99
IGL03083:Dctn1	APN	6	83197484	splice site	probably benign
IGL03394:Dctn1	APN	6	83191284	missense	possibly damaging	0.61
E0374:Dctn1	UTSW	6	83194174	missense	possibly damaging	0.93
IGL03014:Dctn1	UTSW	6	83197369	intron	probably benign
PIT4812001:Dctn1	UTSW	6	83199762	missense	possibly damaging	0.86
R0044:Dctn1	UTSW	6	83191134	missense	probably damaging	1.00
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0057:Dctn1	UTSW	6	83179892	missense	probably benign	0.14
R0731:Dctn1	UTSW	6	83183089	missense	probably damaging	0.98
R0738:Dctn1	UTSW	6	83190107	critical splice donor site	probably null
R0839:Dctn1	UTSW	6	83190477	missense	possibly damaging	0.53
R1035:Dctn1	UTSW	6	83190220	missense	probably damaging	1.00
R1454:Dctn1	UTSW	6	83197508	missense	possibly damaging	0.93
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1627:Dctn1	UTSW	6	83195082	missense	probably damaging	0.99
R1631:Dctn1	UTSW	6	83197596	missense	possibly damaging	0.56
R1812:Dctn1	UTSW	6	83192518	missense	possibly damaging	0.85
R1928:Dctn1	UTSW	6	83199184	splice site	probably benign
R2008:Dctn1	UTSW	6	83189956	missense	probably damaging	0.99
R2242:Dctn1	UTSW	6	83199705	missense	probably damaging	0.99
R2259:Dctn1	UTSW	6	83197586	missense	possibly damaging	0.46
R2422:Dctn1	UTSW	6	83199800	missense	possibly damaging	0.92
R2483:Dctn1	UTSW	6	83194187	missense	probably damaging	1.00
R4455:Dctn1	UTSW	6	83195049	missense	probably damaging	1.00
R4724:Dctn1	UTSW	6	83189938	missense	possibly damaging	0.53
R4812:Dctn1	UTSW	6	83189937	missense	probably benign	0.24
R4819:Dctn1	UTSW	6	83190519	missense	probably damaging	0.97
R4831:Dctn1	UTSW	6	83199771	missense	possibly damaging	0.46
R4928:Dctn1	UTSW	6	83189207	missense	possibly damaging	0.73
R5087:Dctn1	UTSW	6	83191639	missense	probably damaging	1.00
R5354:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R5372:Dctn1	UTSW	6	83190210	missense	probably damaging	0.96
R5493:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5494:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5732:Dctn1	UTSW	6	83197949	critical splice donor site	probably null
R5856:Dctn1	UTSW	6	83197865	missense	probably damaging	1.00
R6025:Dctn1	UTSW	6	83193691	splice site	probably null
R6999:Dctn1	UTSW	6	83191281	missense	possibly damaging	0.89
R7052:Dctn1	UTSW	6	83195280	splice site	probably null
R7133:Dctn1	UTSW	6	83180044	splice site	probably null
R7485:Dctn1	UTSW	6	83189905	missense	possibly damaging	0.85
R7607:Dctn1	UTSW	6	83195069	nonsense	probably null
R7729:Dctn1	UTSW	6	83183060	missense	probably damaging	1.00
R7749:Dctn1	UTSW	6	83186141	intron	probably benign
R8282:Dctn1	UTSW	6	83199756	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GTGCCAAGGGAGGAACCTTGTAATC -3'
(R):5'- GGTGCCTGGACTCTGTTCTTACCTTAG -3'

Sequencing Primer
(F):5'- AGGGAGGAACCTTGTAATCTTATGTC -3'
(R):5'- TTCTTACCTTAGAGGGAGATGGAAG -3'

Posted On

2013-09-30