Mutagenetix > Incidental Mutation

Incidental Mutation 'R9289:Pcnx'

704161

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9289 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81982079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1044 (D1044E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]

AlphaFold

Q9QYC1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021567
AA Change: D1683E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: D1683E

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221721
AA Change: D1677E

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000222005

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	C	T	5: 145,045,523	T306I	probably benign	Het
Aurkb	T	C	11: 69,050,349	I250T	probably damaging	Het
C1qtnf1	A	G	11: 118,443,846	T51A	probably benign	Het
C1rb	G	T	6: 124,575,313	R330L	possibly damaging	Het
Cd8b1	G	A	6: 71,329,793		probably null	Het
Cep57l1	A	T	10: 41,731,086	D160E	probably damaging	Het
Ces1f	C	T	8: 93,265,863	S320N	probably benign	Het
Cfap54	A	G	10: 92,821,074	S3039P	possibly damaging	Het
Chia1	A	T	3: 106,115,186		probably benign	Het
Chka	T	G	19: 3,885,953	F220V	possibly damaging	Het
Cmtm2b	A	G	8: 104,322,348		probably benign	Het
Dhx30	T	C	9: 110,091,535	T304A	possibly damaging	Het
Dhx30	A	T	9: 110,093,121	D164E	probably benign	Het
Dip2b	A	T	15: 100,173,271	K661I	probably damaging	Het
Dlgap4	G	T	2: 156,704,594	R394L	possibly damaging	Het
Dopey2	T	A	16: 93,771,793	L1581H	probably damaging	Het
Fam219a	C	A	4: 41,521,942	G46V	probably damaging	Het
Fer1l6	G	A	15: 58,618,917	V1028M	probably damaging	Het
Glb1	C	A	9: 114,420,490	A129E	probably damaging	Het
Gm11492	T	A	11: 87,568,966	C513*	probably null	Het
Heatr1	T	C	13: 12,432,727	V1767A	probably benign	Het
Ift88	T	A	14: 57,480,742	S591T	probably benign	Het
Itgb4	A	G	11: 115,994,361	K1023R	probably benign	Het
Mfng	C	A	15: 78,759,257	S250I	probably damaging	Het
Mmp9	A	G	2: 164,954,880	T723A	probably benign	Het
Mzf1	T	A	7: 13,051,607	H299L	probably benign	Het
Naa40	T	C	19: 7,234,120	K47E	possibly damaging	Het
Ncdn	A	C	4: 126,750,110	F306L	possibly damaging	Het
Notch3	A	G	17: 32,158,280	C246R	probably damaging	Het
Npc1l1	A	T	11: 6,218,355	Y945*	probably null	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Olfr1384	C	T	11: 49,513,808	P57S	probably damaging	Het
Olfr332	T	A	11: 58,489,919	I279L	probably benign	Het
Olfr669	T	C	7: 104,938,609	W28R	probably damaging	Het
Pgm2l1	T	A	7: 100,270,422	I575K	probably damaging	Het
Plat	T	C	8: 22,782,084	I553T	probably damaging	Het
Prrc2c	A	G	1: 162,679,561	V2513A	probably benign	Het
Qser1	A	T	2: 104,787,248	V983E	possibly damaging	Het
Ring1	A	G	17: 34,022,573	S190P	possibly damaging	Het
Rnf150	A	G	8: 82,990,353	E163G	probably benign	Het
Scgb2b12	T	C	7: 32,326,635	H44R	probably benign	Het
Shtn1	T	C	19: 59,009,825	K379E	probably damaging	Het
Slc52a2	G	T	15: 76,540,275	V238L	probably benign	Het
Smg1	T	C	7: 118,145,416	H3171R	possibly damaging	Het
Tada3	A	G	6: 113,370,303	V342A	possibly damaging	Het
Tbc1d20	T	C	2: 152,311,342	V264A	probably damaging	Het
Tmco5	G	A	2: 116,880,264	A22T	probably benign	Het
Tmem63b	A	G	17: 45,664,771	F549S	probably benign	Het
Trav16d-dv11	T	C	14: 53,047,629	F54S	probably benign	Het
Trim7	A	T	11: 48,845,454	K5*	probably null	Het
Usp48	G	A	4: 137,613,685	G332E	probably benign	Het
Zfp78	T	C	7: 6,378,368	I139T	probably benign	Het
Zfp839	T	A	12: 110,868,444	V711D	probably benign	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0086:Pcnx	UTSW	12	81992058	unclassified	probably benign
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1774:Pcnx	UTSW	12	81975320	missense	probably damaging	1.00
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6753:Pcnx	UTSW	12	81964480	missense	probably damaging	1.00
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6778:Pcnx	UTSW	12	81918871	missense	probably damaging	1.00
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	splice site	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8021:Pcnx	UTSW	12	81918819	nonsense	probably null
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
R8078:Pcnx	UTSW	12	81975280	missense
R8093:Pcnx	UTSW	12	81918819	nonsense	probably null
R8104:Pcnx	UTSW	12	81983611	nonsense	probably null
R8108:Pcnx	UTSW	12	81918819	nonsense	probably null
R8109:Pcnx	UTSW	12	81918819	nonsense	probably null
R8131:Pcnx	UTSW	12	81918518	missense	possibly damaging	0.80
R8136:Pcnx	UTSW	12	81918006	missense	probably benign
R8153:Pcnx	UTSW	12	81918819	nonsense	probably null
R8156:Pcnx	UTSW	12	81918819	nonsense	probably null
R8202:Pcnx	UTSW	12	81895047	missense	probably benign	0.00
R8362:Pcnx	UTSW	12	81967056	missense
R8515:Pcnx	UTSW	12	81962716	missense	possibly damaging	0.83
R8803:Pcnx	UTSW	12	81993151	missense	possibly damaging	0.85
R8820:Pcnx	UTSW	12	81973248	missense
R8828:Pcnx	UTSW	12	81995823	missense	probably damaging	1.00
R8946:Pcnx	UTSW	12	81971384	missense	probably damaging	0.96
R8964:Pcnx	UTSW	12	81993038	missense
R9152:Pcnx	UTSW	12	81975815	missense
R9256:Pcnx	UTSW	12	81973273	missense
R9414:Pcnx	UTSW	12	81918204	missense	probably damaging	1.00
R9445:Pcnx	UTSW	12	81918207	missense	probably damaging	0.98
R9595:Pcnx	UTSW	12	81918914	missense	not run
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- AGGTACCTACTGTCAGCAGC -3'
(R):5'- CAACAGTCCTAAATGAATGTCAGC -3'

Sequencing Primer
(F):5'- CTACTGTCAGCAGCGGGAAG -3'
(R):5'- TGGCAACAGATACATGGACC -3'

Posted On

2022-03-25