Incidental Mutation 'R9289:Slc52a2'
ID 704167
Institutional Source Beutler Lab
Gene Symbol Slc52a2
Ensembl Gene ENSMUSG00000022560
Gene Name solute carrier protein 52, member 2
Synonyms GPCR42, Gpr172b, D15Ertd747e, 2010003P03Rik, PAR2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 76538832-76544608 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76540275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 238 (V238L)
Ref Sequence ENSEMBL: ENSMUSP00000023220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220]
AlphaFold Q9D8F3
Predicted Effect probably benign
Transcript: ENSMUST00000023219
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
AA Change: V238L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560
AA Change: V238L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein which belongs to the riboflavin transporter family. In humans, riboflavin must be obtained by intestinal absorption because it cannot be synthesized by the body. The water-soluble vitamin riboflavin is processed to the coenzymes flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) which then act as intermediaries in many cellular metabolic reactions. Paralogous members of the riboflavin transporter gene family are located on chromosomes 17 and 20. Unlike other members of this family, this gene has higher expression in brain tissue than small intestine. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene have been associated with Brown-Vialetto-Van Laere syndrome 2 - an autosomal recessive progressive neurologic disorder characterized by deafness, bulbar dysfunction, and axial and limb hypotonia. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Chka T G 19: 3,885,953 F220V possibly damaging Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Slc52a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Slc52a2 APN 15 76540576 missense probably benign 0.09
R1118:Slc52a2 UTSW 15 76539608 unclassified probably benign
R1167:Slc52a2 UTSW 15 76539591 missense probably benign 0.05
R1358:Slc52a2 UTSW 15 76540069 missense probably benign 0.00
R4683:Slc52a2 UTSW 15 76540233 missense probably damaging 1.00
R5015:Slc52a2 UTSW 15 76540551 missense probably damaging 1.00
R5732:Slc52a2 UTSW 15 76541074 missense probably benign 0.32
R9301:Slc52a2 UTSW 15 76540206 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGGTCTTTCTTCCTGGGTCAG -3'
(R):5'- CCATTGGTCAGAGCATTGGTG -3'

Sequencing Primer
(F):5'- TGCATGTGCCTGCCAACAG -3'
(R):5'- AGCATTGGTGATGGCCAGC -3'
Posted On 2022-03-25