Mutagenetix > Incidental Mutations

Incidental Mutation 'R9289:Chka'

704175

Institutional Source

Beutler Lab

Gene Symbol

Chka

Ensembl Gene

ENSMUSG00000024843

Gene Name

choline kinase alpha

Synonyms

choline/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9289 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3851773-3894369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 3885953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 220 (F220V)

Ref Sequence

ENSEMBL: ENSMUSP00000071933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]

AlphaFold

O54804

Predicted Effect

probably benign
Transcript: ENSMUST00000025760
AA Change: F238V

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843
AA Change: F238V

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	53	74	N/A	INTRINSIC
Pfam:APH	108	373	2.4e-11	PFAM
Pfam:Choline_kinase	135	370	8.2e-82	PFAM
Pfam:EcKinase	211	345	2.5e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072055
AA Change: F220V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843
AA Change: F220V

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	53	74	N/A	INTRINSIC
Pfam:APH	108	358	6.4e-12	PFAM
Pfam:Choline_kinase	135	352	1.6e-84	PFAM
Pfam:EcKinase	190	329	2e-7	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843
AA Change: F161V

Domain	Start	End	E-Value	Type
Pfam:Choline_kinase	40	230	2.2e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128694

SMART Domains

Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
PDB:4DA5\|B	1	150	2e-60	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000139655

SMART Domains

Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
PDB:4DA5\|B	17	160	3e-68	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000153343

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	C	T	5: 145,045,523	T306I	probably benign	Het
Aurkb	T	C	11: 69,050,349	I250T	probably damaging	Het
C1qtnf1	A	G	11: 118,443,846	T51A	probably benign	Het
C1rb	G	T	6: 124,575,313	R330L	possibly damaging	Het
Cd8b1	G	A	6: 71,329,793		probably null	Het
Cep57l1	A	T	10: 41,731,086	D160E	probably damaging	Het
Ces1f	C	T	8: 93,265,863	S320N	probably benign	Het
Cfap54	A	G	10: 92,821,074	S3039P	possibly damaging	Het
Chia1	A	T	3: 106,115,186		probably benign	Het
Cmtm2b	A	G	8: 104,322,348		probably benign	Het
Dhx30	T	C	9: 110,091,535	T304A	possibly damaging	Het
Dhx30	A	T	9: 110,093,121	D164E	probably benign	Het
Dip2b	A	T	15: 100,173,271	K661I	probably damaging	Het
Dlgap4	G	T	2: 156,704,594	R394L	possibly damaging	Het
Dopey2	T	A	16: 93,771,793	L1581H	probably damaging	Het
Fam219a	C	A	4: 41,521,942	G46V	probably damaging	Het
Fer1l6	G	A	15: 58,618,917	V1028M	probably damaging	Het
Glb1	C	A	9: 114,420,490	A129E	probably damaging	Het
Gm11492	T	A	11: 87,568,966	C513*	probably null	Het
Heatr1	T	C	13: 12,432,727	V1767A	probably benign	Het
Ift88	T	A	14: 57,480,742	S591T	probably benign	Het
Itgb4	A	G	11: 115,994,361	K1023R	probably benign	Het
Mfng	C	A	15: 78,759,257	S250I	probably damaging	Het
Mmp9	A	G	2: 164,954,880	T723A	probably benign	Het
Mzf1	T	A	7: 13,051,607	H299L	probably benign	Het
Naa40	T	C	19: 7,234,120	K47E	possibly damaging	Het
Ncdn	A	C	4: 126,750,110	F306L	possibly damaging	Het
Notch3	A	G	17: 32,158,280	C246R	probably damaging	Het
Npc1l1	A	T	11: 6,218,355	Y945*	probably null	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Olfr1384	C	T	11: 49,513,808	P57S	probably damaging	Het
Olfr332	T	A	11: 58,489,919	I279L	probably benign	Het
Olfr669	T	C	7: 104,938,609	W28R	probably damaging	Het
Pcnx	C	A	12: 81,982,079	D1044E		Het
Pgm2l1	T	A	7: 100,270,422	I575K	probably damaging	Het
Plat	T	C	8: 22,782,084	I553T	probably damaging	Het
Prrc2c	A	G	1: 162,679,561	V2513A	probably benign	Het
Qser1	A	T	2: 104,787,248	V983E	possibly damaging	Het
Ring1	A	G	17: 34,022,573	S190P	possibly damaging	Het
Rnf150	A	G	8: 82,990,353	E163G	probably benign	Het
Scgb2b12	T	C	7: 32,326,635	H44R	probably benign	Het
Shtn1	T	C	19: 59,009,825	K379E	probably damaging	Het
Slc52a2	G	T	15: 76,540,275	V238L	probably benign	Het
Smg1	T	C	7: 118,145,416	H3171R	possibly damaging	Het
Tada3	A	G	6: 113,370,303	V342A	possibly damaging	Het
Tbc1d20	T	C	2: 152,311,342	V264A	probably damaging	Het
Tmco5	G	A	2: 116,880,264	A22T	probably benign	Het
Tmem63b	A	G	17: 45,664,771	F549S	probably benign	Het
Trav16d-dv11	T	C	14: 53,047,629	F54S	probably benign	Het
Trim7	A	T	11: 48,845,454	K5*	probably null	Het
Usp48	G	A	4: 137,613,685	G332E	probably benign	Het
Zfp78	T	C	7: 6,378,368	I139T	probably benign	Het
Zfp839	T	A	12: 110,868,444	V711D	probably benign	Het

Other mutations in Chka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Chka	APN	19	3892189	missense	probably benign	0.16
IGL02630:Chka	APN	19	3892112	missense	possibly damaging	0.94
R1432:Chka	UTSW	19	3874809	splice site	probably benign
R1840:Chka	UTSW	19	3886460	missense	probably benign	0.00
R1898:Chka	UTSW	19	3892205	missense	probably damaging	1.00
R3822:Chka	UTSW	19	3882038	intron	probably benign
R4272:Chka	UTSW	19	3875737	splice site	probably benign
R4329:Chka	UTSW	19	3875803	splice site	probably benign
R4573:Chka	UTSW	19	3885960	missense	probably damaging	1.00
R4720:Chka	UTSW	19	3886375	missense	probably damaging	0.99
R4923:Chka	UTSW	19	3892105	critical splice acceptor site	probably null
R5783:Chka	UTSW	19	3864661	missense	probably damaging	1.00
R5936:Chka	UTSW	19	3884580	missense	probably benign	0.25
R5979:Chka	UTSW	19	3884513	missense	probably damaging	1.00
R7429:Chka	UTSW	19	3892787	missense	probably damaging	1.00
R7430:Chka	UTSW	19	3892787	missense	probably damaging	1.00
R8189:Chka	UTSW	19	3875759	nonsense	probably null
R8213:Chka	UTSW	19	3885882	missense	probably damaging	1.00
R8397:Chka	UTSW	19	3852414	critical splice donor site	probably null
R8440:Chka	UTSW	19	3893375	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTAACTGGTTCCTGGTTCTAAGG -3'
(R):5'- AGTCTTCATTCTTGGTCCAGG -3'

Sequencing Primer
(F):5'- CTAAGGTGGTGCGGTCTTAGTACAG -3'
(R):5'- CTTGGTCCAGGAATTGATACATGC -3'

Posted On

2022-03-25