Incidental Mutation 'R9289:Chka'
ID 704175
Institutional Source Beutler Lab
Gene Symbol Chka
Ensembl Gene ENSMUSG00000024843
Gene Name choline kinase alpha
Synonyms choline/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9289 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 3851773-3894369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3885953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 220 (F220V)
Ref Sequence ENSEMBL: ENSMUSP00000071933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]
AlphaFold O54804
Predicted Effect probably benign
Transcript: ENSMUST00000025760
AA Change: F238V

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843
AA Change: F238V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072055
AA Change: F220V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843
AA Change: F220V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843
AA Change: F161V

DomainStartEndE-ValueType
Pfam:Choline_kinase 40 230 2.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139655
SMART Domains Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
PDB:4DA5|B 17 160 3e-68 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000153343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,523 T306I probably benign Het
Aurkb T C 11: 69,050,349 I250T probably damaging Het
C1qtnf1 A G 11: 118,443,846 T51A probably benign Het
C1rb G T 6: 124,575,313 R330L possibly damaging Het
Cd8b1 G A 6: 71,329,793 probably null Het
Cep57l1 A T 10: 41,731,086 D160E probably damaging Het
Ces1f C T 8: 93,265,863 S320N probably benign Het
Cfap54 A G 10: 92,821,074 S3039P possibly damaging Het
Chia1 A T 3: 106,115,186 probably benign Het
Cmtm2b A G 8: 104,322,348 probably benign Het
Dhx30 T C 9: 110,091,535 T304A possibly damaging Het
Dhx30 A T 9: 110,093,121 D164E probably benign Het
Dip2b A T 15: 100,173,271 K661I probably damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dopey2 T A 16: 93,771,793 L1581H probably damaging Het
Fam219a C A 4: 41,521,942 G46V probably damaging Het
Fer1l6 G A 15: 58,618,917 V1028M probably damaging Het
Glb1 C A 9: 114,420,490 A129E probably damaging Het
Gm11492 T A 11: 87,568,966 C513* probably null Het
Heatr1 T C 13: 12,432,727 V1767A probably benign Het
Ift88 T A 14: 57,480,742 S591T probably benign Het
Itgb4 A G 11: 115,994,361 K1023R probably benign Het
Mfng C A 15: 78,759,257 S250I probably damaging Het
Mmp9 A G 2: 164,954,880 T723A probably benign Het
Mzf1 T A 7: 13,051,607 H299L probably benign Het
Naa40 T C 19: 7,234,120 K47E possibly damaging Het
Ncdn A C 4: 126,750,110 F306L possibly damaging Het
Notch3 A G 17: 32,158,280 C246R probably damaging Het
Npc1l1 A T 11: 6,218,355 Y945* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1384 C T 11: 49,513,808 P57S probably damaging Het
Olfr332 T A 11: 58,489,919 I279L probably benign Het
Olfr669 T C 7: 104,938,609 W28R probably damaging Het
Pcnx C A 12: 81,982,079 D1044E Het
Pgm2l1 T A 7: 100,270,422 I575K probably damaging Het
Plat T C 8: 22,782,084 I553T probably damaging Het
Prrc2c A G 1: 162,679,561 V2513A probably benign Het
Qser1 A T 2: 104,787,248 V983E possibly damaging Het
Ring1 A G 17: 34,022,573 S190P possibly damaging Het
Rnf150 A G 8: 82,990,353 E163G probably benign Het
Scgb2b12 T C 7: 32,326,635 H44R probably benign Het
Shtn1 T C 19: 59,009,825 K379E probably damaging Het
Slc52a2 G T 15: 76,540,275 V238L probably benign Het
Smg1 T C 7: 118,145,416 H3171R possibly damaging Het
Tada3 A G 6: 113,370,303 V342A possibly damaging Het
Tbc1d20 T C 2: 152,311,342 V264A probably damaging Het
Tmco5 G A 2: 116,880,264 A22T probably benign Het
Tmem63b A G 17: 45,664,771 F549S probably benign Het
Trav16d-dv11 T C 14: 53,047,629 F54S probably benign Het
Trim7 A T 11: 48,845,454 K5* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp78 T C 7: 6,378,368 I139T probably benign Het
Zfp839 T A 12: 110,868,444 V711D probably benign Het
Other mutations in Chka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Chka APN 19 3892189 missense probably benign 0.16
IGL02630:Chka APN 19 3892112 missense possibly damaging 0.94
R1432:Chka UTSW 19 3874809 splice site probably benign
R1840:Chka UTSW 19 3886460 missense probably benign 0.00
R1898:Chka UTSW 19 3892205 missense probably damaging 1.00
R3822:Chka UTSW 19 3882038 intron probably benign
R4272:Chka UTSW 19 3875737 splice site probably benign
R4329:Chka UTSW 19 3875803 splice site probably benign
R4573:Chka UTSW 19 3885960 missense probably damaging 1.00
R4720:Chka UTSW 19 3886375 missense probably damaging 0.99
R4923:Chka UTSW 19 3892105 critical splice acceptor site probably null
R5783:Chka UTSW 19 3864661 missense probably damaging 1.00
R5936:Chka UTSW 19 3884580 missense probably benign 0.25
R5979:Chka UTSW 19 3884513 missense probably damaging 1.00
R7429:Chka UTSW 19 3892787 missense probably damaging 1.00
R7430:Chka UTSW 19 3892787 missense probably damaging 1.00
R8189:Chka UTSW 19 3875759 nonsense probably null
R8213:Chka UTSW 19 3885882 missense probably damaging 1.00
R8397:Chka UTSW 19 3852414 critical splice donor site probably null
R8440:Chka UTSW 19 3893375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAACTGGTTCCTGGTTCTAAGG -3'
(R):5'- AGTCTTCATTCTTGGTCCAGG -3'

Sequencing Primer
(F):5'- CTAAGGTGGTGCGGTCTTAGTACAG -3'
(R):5'- CTTGGTCCAGGAATTGATACATGC -3'
Posted On 2022-03-25