Incidental Mutation 'R9290:Dnah11'
ID 704227
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock # R9290 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 117877982-118199043 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118027516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 2372 (E2372K)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084806
AA Change: E2372K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: E2372K

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176756
AA Change: E468K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,624,553 R755W probably damaging Het
Abl2 A G 1: 156,629,968 K268R probably damaging Het
Acvr1 T C 2: 58,448,318 D464G probably damaging Het
Adra1d G T 2: 131,561,978 T64K probably benign Het
Casc1 T C 6: 145,202,962 E57G unknown Het
Cct3 T C 3: 88,309,229 V164A probably benign Het
Cdhr2 T C 13: 54,734,196 V1153A possibly damaging Het
Cdkn2c A C 4: 109,661,315 Y147* probably null Het
Ces1g A T 8: 93,302,917 H562Q probably benign Het
Cfap221 A G 1: 119,925,651 L771P probably benign Het
Chsy3 A G 18: 59,409,856 M689V probably benign Het
Ciita T A 16: 10,508,649 S235T probably damaging Het
Dcdc2a A G 13: 25,202,330 K396E probably benign Het
Dgki C T 6: 37,299,845 C35Y unknown Het
Eif3a A G 19: 60,776,783 V322A probably damaging Het
Fam71d T A 12: 78,712,254 V116E possibly damaging Het
Foxp2 A T 6: 15,197,121 Q54L possibly damaging Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gtf3c3 T G 1: 54,438,838 E26A possibly damaging Het
Hps5 T C 7: 46,774,907 E514G probably damaging Het
Ide A T 19: 37,325,248 D154E Het
Insm1 T C 2: 146,223,353 V363A probably benign Het
Iqgap2 A T 13: 95,750,015 M120K probably damaging Het
Kcnh5 T A 12: 74,976,714 I527F probably benign Het
Lrtm2 A G 6: 119,320,831 L83P probably damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Mycbp2 A T 14: 103,188,524 H2421Q probably damaging Het
Myh15 A G 16: 49,177,012 E1731G probably damaging Het
Myt1 A T 2: 181,795,874 H168L probably benign Het
Nxph4 A T 10: 127,526,677 V115E probably damaging Het
Ofcc1 A T 13: 40,280,326 I101N possibly damaging Het
Olfr1131 A G 2: 87,628,865 N18S probably benign Het
Olfr1220 A G 2: 89,097,732 L65P probably damaging Het
Olfr1307 A T 2: 111,944,622 I278N possibly damaging Het
Olfr912 T C 9: 38,582,038 S254P probably damaging Het
Olfr944 A G 9: 39,218,235 R293G probably damaging Het
Oog2 T C 4: 144,196,445 F427L probably benign Het
Otop1 T G 5: 38,297,958 I232S probably benign Het
Pak6 G A 2: 118,693,402 R346Q probably damaging Het
Pbk A T 14: 65,817,264 M282L probably benign Het
Pmpcb T C 5: 21,739,011 probably null Het
Pou5f2 T A 13: 78,025,466 W176R probably damaging Het
Prkra G T 2: 76,647,803 S18R probably benign Het
Prune2 G T 19: 17,168,327 A2764S probably benign Het
Ptpdc1 A T 13: 48,586,745 D403E probably benign Het
Pxylp1 T C 9: 96,840,036 E54G probably damaging Het
Rap1gap G A 4: 137,718,911 A325T probably damaging Het
Rbpj T C 5: 53,653,403 V455A probably damaging Het
Rptor A T 11: 119,811,997 I397F probably benign Het
Sacs G A 14: 61,184,050 M148I probably benign Het
Sec16b A G 1: 157,546,246 Q496R probably damaging Het
Sned1 C A 1: 93,271,663 C488* probably null Het
Snupn G T 9: 56,975,263 V187F possibly damaging Het
Sorcs2 T C 5: 36,025,881 D1016G probably damaging Het
Spta1 T C 1: 174,217,638 M1517T possibly damaging Het
Them4 G T 3: 94,324,323 G156C probably damaging Het
Tnik T C 3: 28,620,975 S721P probably benign Het
Trpm8 T C 1: 88,319,045 S26P probably damaging Het
Ube2e3 A G 2: 78,919,980 I183M probably damaging Het
Uhrf2 A G 19: 30,078,016 Y389C probably damaging Het
Utp4 T A 8: 106,916,196 D495E possibly damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Vmn1r219 G A 13: 23,163,229 G196E probably damaging Het
Vmn2r101 C T 17: 19,591,133 S493L probably benign Het
Vmn2r61 A G 7: 42,265,961 T111A probably benign Het
Zbtb40 G T 4: 137,018,218 A168E probably benign Het
Zscan18 A T 7: 12,774,127 I482N probably damaging Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 splice site probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 splice site probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
R7000:Dnah11 UTSW 12 118017661 missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117922018 frame shift probably null
R7101:Dnah11 UTSW 12 118068145 missense probably benign
R7106:Dnah11 UTSW 12 117961149 missense probably benign 0.15
R7203:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118041095 missense possibly damaging 0.95
R7219:Dnah11 UTSW 12 118126889 missense probably benign 0.00
R7308:Dnah11 UTSW 12 117995275 missense probably damaging 1.00
R7361:Dnah11 UTSW 12 118018742 missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117987442 missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118027477 missense probably benign 0.00
R7399:Dnah11 UTSW 12 118125785 missense probably damaging 1.00
R7404:Dnah11 UTSW 12 118104808 missense probably benign 0.36
R7473:Dnah11 UTSW 12 117903176 missense probably benign 0.19
R7545:Dnah11 UTSW 12 117931204 missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118140770 splice site probably null
R7625:Dnah11 UTSW 12 118196642 missense probably benign
R7761:Dnah11 UTSW 12 118023913 missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118041009 missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117987502 missense probably benign 0.04
R7904:Dnah11 UTSW 12 117903268 missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117966633 missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117878549 missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 118012446 missense probably benign
R8254:Dnah11 UTSW 12 117878524 missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 118027508 nonsense probably null
R8272:Dnah11 UTSW 12 118111017 missense probably benign 0.01
R8344:Dnah11 UTSW 12 118085731 missense probably benign 0.00
R8515:Dnah11 UTSW 12 117975798 missense probably damaging 1.00
R8528:Dnah11 UTSW 12 118008803 missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117878512 missense probably benign
R8676:Dnah11 UTSW 12 118190804 missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118085649 critical splice donor site probably null
R8773:Dnah11 UTSW 12 117995215 missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117911029 missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118192372 missense probably benign 0.03
R8866:Dnah11 UTSW 12 118192372 missense probably benign 0.03
R8881:Dnah11 UTSW 12 118113912 missense probably benign 0.00
R8881:Dnah11 UTSW 12 118126815 missense probably benign 0.05
R8920:Dnah11 UTSW 12 118113939 missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118127646 missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 118023983 missense probably benign 0.36
R8962:Dnah11 UTSW 12 117952538 missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117954895 missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118130843 missense probably benign 0.00
R9155:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9162:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9164:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117931183 missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118190897 missense probably benign
R9205:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9208:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117987360 missense probably damaging 1.00
R9264:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R9291:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118179606 missense probably benign 0.11
R9353:Dnah11 UTSW 12 118179699 missense probably benign 0.00
R9375:Dnah11 UTSW 12 117920968 missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118047320 nonsense probably null
R9392:Dnah11 UTSW 12 118177555 missense probably benign 0.00
R9433:Dnah11 UTSW 12 118012272 missense probably damaging 1.00
RF023:Dnah11 UTSW 12 117954850 missense probably damaging 1.00
RF047:Dnah11 UTSW 12 118010083 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 117931177 missense possibly damaging 0.81
Z1176:Dnah11 UTSW 12 118127119 missense probably benign 0.00
Z1176:Dnah11 UTSW 12 118130799 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCTGAACTCCTAGGCTCAG -3'
(R):5'- CTCTAACTTCAACATCCCAGGG -3'

Sequencing Primer
(F):5'- CTGAACTCCTAGGCTCAGAAGAAG -3'
(R):5'- AACATCCCAGGGACACTCATTTTTC -3'
Posted On 2022-03-25