Incidental Mutation 'R9290:Iqgap2'
ID 704234
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene Name IQ motif containing GTPase activating protein 2
Synonyms 4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9290 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 95627177-95891922 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95750015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 120 (M120K)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
AlphaFold Q3UQ44
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: M120K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: M120K

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,624,553 R755W probably damaging Het
Abl2 A G 1: 156,629,968 K268R probably damaging Het
Acvr1 T C 2: 58,448,318 D464G probably damaging Het
Adra1d G T 2: 131,561,978 T64K probably benign Het
Casc1 T C 6: 145,202,962 E57G unknown Het
Cct3 T C 3: 88,309,229 V164A probably benign Het
Cdhr2 T C 13: 54,734,196 V1153A possibly damaging Het
Cdkn2c A C 4: 109,661,315 Y147* probably null Het
Ces1g A T 8: 93,302,917 H562Q probably benign Het
Cfap221 A G 1: 119,925,651 L771P probably benign Het
Chsy3 A G 18: 59,409,856 M689V probably benign Het
Ciita T A 16: 10,508,649 S235T probably damaging Het
Dcdc2a A G 13: 25,202,330 K396E probably benign Het
Dgki C T 6: 37,299,845 C35Y unknown Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Eif3a A G 19: 60,776,783 V322A probably damaging Het
Fam71d T A 12: 78,712,254 V116E possibly damaging Het
Foxp2 A T 6: 15,197,121 Q54L possibly damaging Het
Gm19410 T A 8: 35,802,232 C1074S probably damaging Het
Gtf3c3 T G 1: 54,438,838 E26A possibly damaging Het
Hps5 T C 7: 46,774,907 E514G probably damaging Het
Ide A T 19: 37,325,248 D154E Het
Insm1 T C 2: 146,223,353 V363A probably benign Het
Kcnh5 T A 12: 74,976,714 I527F probably benign Het
Lrtm2 A G 6: 119,320,831 L83P probably damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Mycbp2 A T 14: 103,188,524 H2421Q probably damaging Het
Myh15 A G 16: 49,177,012 E1731G probably damaging Het
Myt1 A T 2: 181,795,874 H168L probably benign Het
Nxph4 A T 10: 127,526,677 V115E probably damaging Het
Ofcc1 A T 13: 40,280,326 I101N possibly damaging Het
Olfr1131 A G 2: 87,628,865 N18S probably benign Het
Olfr1220 A G 2: 89,097,732 L65P probably damaging Het
Olfr1307 A T 2: 111,944,622 I278N possibly damaging Het
Olfr912 T C 9: 38,582,038 S254P probably damaging Het
Olfr944 A G 9: 39,218,235 R293G probably damaging Het
Oog2 T C 4: 144,196,445 F427L probably benign Het
Otop1 T G 5: 38,297,958 I232S probably benign Het
Pak6 G A 2: 118,693,402 R346Q probably damaging Het
Pbk A T 14: 65,817,264 M282L probably benign Het
Pmpcb T C 5: 21,739,011 probably null Het
Pou5f2 T A 13: 78,025,466 W176R probably damaging Het
Prkra G T 2: 76,647,803 S18R probably benign Het
Prune2 G T 19: 17,168,327 A2764S probably benign Het
Ptpdc1 A T 13: 48,586,745 D403E probably benign Het
Pxylp1 T C 9: 96,840,036 E54G probably damaging Het
Rap1gap G A 4: 137,718,911 A325T probably damaging Het
Rbpj T C 5: 53,653,403 V455A probably damaging Het
Rptor A T 11: 119,811,997 I397F probably benign Het
Sacs G A 14: 61,184,050 M148I probably benign Het
Sec16b A G 1: 157,546,246 Q496R probably damaging Het
Sned1 C A 1: 93,271,663 C488* probably null Het
Snupn G T 9: 56,975,263 V187F possibly damaging Het
Sorcs2 T C 5: 36,025,881 D1016G probably damaging Het
Spta1 T C 1: 174,217,638 M1517T possibly damaging Het
Them4 G T 3: 94,324,323 G156C probably damaging Het
Tnik T C 3: 28,620,975 S721P probably benign Het
Trpm8 T C 1: 88,319,045 S26P probably damaging Het
Ube2e3 A G 2: 78,919,980 I183M probably damaging Het
Uhrf2 A G 19: 30,078,016 Y389C probably damaging Het
Utp4 T A 8: 106,916,196 D495E possibly damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Vmn1r219 G A 13: 23,163,229 G196E probably damaging Het
Vmn2r101 C T 17: 19,591,133 S493L probably benign Het
Vmn2r61 A G 7: 42,265,961 T111A probably benign Het
Zbtb40 G T 4: 137,018,218 A168E probably benign Het
Zscan18 A T 7: 12,774,127 I482N probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
G1Funyon:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
R8845:Iqgap2 UTSW 13 95657884 missense possibly damaging 0.60
R8902:Iqgap2 UTSW 13 95682203 missense probably benign 0.16
R8957:Iqgap2 UTSW 13 95635646 missense probably damaging 1.00
R9153:Iqgap2 UTSW 13 95708039 missense probably benign
R9259:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R9414:Iqgap2 UTSW 13 95646841 missense
R9432:Iqgap2 UTSW 13 95637753 missense probably benign
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAAGCCGGTTCTACCCTTG -3'
(R):5'- TATGAGCAACAATGGCTGCTC -3'

Sequencing Primer
(F):5'- ACACTTTCAATCGTGTGTTTTGTAGC -3'
(R):5'- TGGCTGCTCTTGAAAAAGCAC -3'
Posted On 2022-03-25