Incidental Mutation 'R9291:Atp6v1h'
ID 704246
Institutional Source Beutler Lab
Gene Symbol Atp6v1h
Ensembl Gene ENSMUSG00000033793
Gene Name ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms 0710001F19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 5070018-5162529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 5150061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 464 (W464L)
Ref Sequence ENSEMBL: ENSMUSP00000040756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044369] [ENSMUST00000192698] [ENSMUST00000192847]
AlphaFold Q8BVE3
Predicted Effect probably null
Transcript: ENSMUST00000044369
AA Change: W464L

PolyPhen 2 Score 0.404 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040756
Gene: ENSMUSG00000033793
AA Change: W464L

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 3e-106 PFAM
Pfam:V-ATPase_H_C 348 464 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192698
AA Change: W446L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141797
Gene: ENSMUSG00000033793
AA Change: W446L

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 324 4.4e-104 PFAM
Pfam:V-ATPase_H_C 329 447 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192847
AA Change: W422L

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141636
Gene: ENSMUSG00000033793
AA Change: W422L

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 1e-102 PFAM
Pfam:V-ATPase_H_C 332 423 2.7e-25 PFAM
Pfam:Arm_2 339 427 4.6e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for the allele exhbit bone loss with altered bone absorption and decreased bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,703 N551S probably benign Het
Abcg5 C A 17: 84,668,952 V486L probably benign Het
Acoxl T A 2: 127,972,573 I303N probably damaging Het
Cdcp2 A G 4: 107,106,856 D301G probably damaging Het
Cenpv T C 11: 62,538,862 D115G probably benign Het
Cnfn T C 7: 25,368,051 D67G possibly damaging Het
Col27a1 A C 4: 63,224,302 I76L probably damaging Het
Crb2 G A 2: 37,792,201 V865I probably damaging Het
Ctf1 T A 7: 127,717,032 L58Q probably damaging Het
Dennd6b C T 15: 89,187,387 V276M possibly damaging Het
Dis3l2 A G 1: 86,973,493 T483A possibly damaging Het
Dlg5 T C 14: 24,191,161 T223A probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah8 T C 17: 30,725,125 I1772T probably damaging Het
Dscaml1 T C 9: 45,447,953 I170T probably damaging Het
Ehd4 G T 2: 120,091,274 D500E probably damaging Het
Elac2 T C 11: 64,992,316 I388T probably damaging Het
Entpd6 G A 2: 150,767,039 V348M probably benign Het
Epg5 T A 18: 78,012,850 C1746* probably null Het
Exosc2 G T 2: 31,670,859 M40I probably benign Het
Fam193a T C 5: 34,436,491 Y27H probably damaging Het
Gm13084 A T 4: 143,812,681 Y81N probably benign Het
Gm8005 A G 14: 42,436,928 F148L Het
Hectd4 T C 5: 121,348,965 V3341A probably benign Het
Hecw1 A G 13: 14,316,937 V77A probably benign Het
Irf2bp1 T A 7: 19,004,533 C33S probably damaging Het
Kank4 A T 4: 98,778,451 H586Q probably benign Het
Kcnu1 A G 8: 25,900,013 N619S probably benign Het
Kndc1 A G 7: 139,895,224 E13G possibly damaging Het
Lrp2 A T 2: 69,480,035 D2731E probably damaging Het
Lyst A G 13: 13,709,353 N2942S probably benign Het
Maml3 G A 3: 51,856,907 T212M probably benign Het
Mill2 T C 7: 18,841,491 V41A probably benign Het
Moxd2 C A 6: 40,880,428 C466F probably damaging Het
Nefh A G 11: 4,940,871 S583P probably benign Het
Nlrp9b T A 7: 20,024,586 S583T possibly damaging Het
Nup214 T G 2: 31,977,794 M91R probably benign Het
Olfr1055 A T 2: 86,347,424 I114N probably benign Het
Olfr1226 A C 2: 89,193,794 M80R possibly damaging Het
Olfr776 T C 10: 129,261,333 I124T probably damaging Het
Otud4 A G 8: 79,646,323 Y90C probably damaging Het
Papln C A 12: 83,778,510 T575N probably benign Het
Pkhd1l1 T A 15: 44,569,976 N3417K probably damaging Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Rchy1 A G 5: 91,951,906 L191S possibly damaging Het
Rims1 T C 1: 22,397,522 D296G Het
Sftpb T A 6: 72,309,897 C261* probably null Het
Sgcd C T 11: 46,979,339 C265Y probably damaging Het
Slc44a5 G A 3: 154,256,581 V384M possibly damaging Het
Slx4ip T A 2: 137,046,796 N132K probably benign Het
Sspo C T 6: 48,496,396 T4861M probably damaging Het
Swt1 T A 1: 151,410,943 E266V probably damaging Het
Tbc1d9 A G 8: 83,261,121 D903G probably damaging Het
Tbx18 A T 9: 87,729,482 M165K probably damaging Het
Tmem25 T C 9: 44,795,502 N282S probably damaging Het
Tom1l2 T C 11: 60,262,730 I140M probably benign Het
Trak2 A G 1: 58,903,899 S783P probably damaging Het
Trpv4 G A 5: 114,630,007 T534M probably benign Het
Ttc6 G T 12: 57,575,944 R43M probably damaging Het
Vmn1r194 A G 13: 22,244,705 Y164C probably benign Het
Vmn1r228 T C 17: 20,776,761 Y165C probably benign Het
Vps13b C A 15: 35,846,913 T2614K probably damaging Het
Zdhhc14 T C 17: 5,647,962 F102S probably benign Het
Zyg11b A G 4: 108,250,817 M464T probably benign Het
Other mutations in Atp6v1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Atp6v1h APN 1 5124471 critical splice donor site probably null
IGL00984:Atp6v1h APN 1 5095682 missense probably damaging 1.00
IGL01545:Atp6v1h APN 1 5089059 missense probably benign
IGL01788:Atp6v1h APN 1 5149983 missense possibly damaging 0.81
IGL02317:Atp6v1h APN 1 5084470 missense possibly damaging 0.95
IGL02679:Atp6v1h APN 1 5124302 missense probably damaging 1.00
IGL02944:Atp6v1h APN 1 5093355 splice site probably benign
IGL03119:Atp6v1h APN 1 5095669 missense probably benign 0.34
F5770:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0727:Atp6v1h UTSW 1 5084558 nonsense probably null
R1452:Atp6v1h UTSW 1 5098137 unclassified probably benign
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R2273:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
R4512:Atp6v1h UTSW 1 5098135 critical splice donor site probably null
R4687:Atp6v1h UTSW 1 5133085 missense probably damaging 1.00
R5185:Atp6v1h UTSW 1 5095642 missense probably damaging 1.00
R5628:Atp6v1h UTSW 1 5135889 nonsense probably null
R5843:Atp6v1h UTSW 1 5162089 splice site probably null
R7037:Atp6v1h UTSW 1 5149992 missense possibly damaging 0.77
R7505:Atp6v1h UTSW 1 5124338 missense probably benign
R9098:Atp6v1h UTSW 1 5093415 missense probably damaging 1.00
R9348:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
V7580:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7581:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7582:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7583:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
Z1088:Atp6v1h UTSW 1 5098048 missense probably damaging 1.00
Z1176:Atp6v1h UTSW 1 5095628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTTTACACTTGTAACCTGTGTC -3'
(R):5'- GGCCTCAGTTACAGCTGAAG -3'

Sequencing Primer
(F):5'- CACTTGTAACCTGTGTCAAAGAATG -3'
(R):5'- GGGGTATCAGAAATCTGTACCTTTC -3'
Posted On 2022-03-25