Incidental Mutation 'R9291:1110002E22Rik'
ID 704262
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R9291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 138066703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 551 (N551S)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: N551S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: N551S

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 C A 17: 84,668,952 V486L probably benign Het
Acoxl T A 2: 127,972,573 I303N probably damaging Het
Atp6v1h G T 1: 5,150,061 W464L probably null Het
Cdcp2 A G 4: 107,106,856 D301G probably damaging Het
Cenpv T C 11: 62,538,862 D115G probably benign Het
Cnfn T C 7: 25,368,051 D67G possibly damaging Het
Col27a1 A C 4: 63,224,302 I76L probably damaging Het
Crb2 G A 2: 37,792,201 V865I probably damaging Het
Ctf1 T A 7: 127,717,032 L58Q probably damaging Het
Dennd6b C T 15: 89,187,387 V276M possibly damaging Het
Dis3l2 A G 1: 86,973,493 T483A possibly damaging Het
Dlg5 T C 14: 24,191,161 T223A probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah8 T C 17: 30,725,125 I1772T probably damaging Het
Dscaml1 T C 9: 45,447,953 I170T probably damaging Het
Ehd4 G T 2: 120,091,274 D500E probably damaging Het
Elac2 T C 11: 64,992,316 I388T probably damaging Het
Entpd6 G A 2: 150,767,039 V348M probably benign Het
Epg5 T A 18: 78,012,850 C1746* probably null Het
Exosc2 G T 2: 31,670,859 M40I probably benign Het
Fam193a T C 5: 34,436,491 Y27H probably damaging Het
Gm13084 A T 4: 143,812,681 Y81N probably benign Het
Gm8005 A G 14: 42,436,928 F148L Het
Hectd4 T C 5: 121,348,965 V3341A probably benign Het
Hecw1 A G 13: 14,316,937 V77A probably benign Het
Irf2bp1 T A 7: 19,004,533 C33S probably damaging Het
Kank4 A T 4: 98,778,451 H586Q probably benign Het
Kcnu1 A G 8: 25,900,013 N619S probably benign Het
Kndc1 A G 7: 139,895,224 E13G possibly damaging Het
Lrp2 A T 2: 69,480,035 D2731E probably damaging Het
Lyst A G 13: 13,709,353 N2942S probably benign Het
Maml3 G A 3: 51,856,907 T212M probably benign Het
Mill2 T C 7: 18,841,491 V41A probably benign Het
Moxd2 C A 6: 40,880,428 C466F probably damaging Het
Nefh A G 11: 4,940,871 S583P probably benign Het
Nlrp9b T A 7: 20,024,586 S583T possibly damaging Het
Nup214 T G 2: 31,977,794 M91R probably benign Het
Olfr1055 A T 2: 86,347,424 I114N probably benign Het
Olfr1226 A C 2: 89,193,794 M80R possibly damaging Het
Olfr776 T C 10: 129,261,333 I124T probably damaging Het
Otud4 A G 8: 79,646,323 Y90C probably damaging Het
Papln C A 12: 83,778,510 T575N probably benign Het
Pkhd1l1 T A 15: 44,569,976 N3417K probably damaging Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Rchy1 A G 5: 91,951,906 L191S possibly damaging Het
Rims1 T C 1: 22,397,522 D296G Het
Sftpb T A 6: 72,309,897 C261* probably null Het
Sgcd C T 11: 46,979,339 C265Y probably damaging Het
Slc44a5 G A 3: 154,256,581 V384M possibly damaging Het
Slx4ip T A 2: 137,046,796 N132K probably benign Het
Sspo C T 6: 48,496,396 T4861M probably damaging Het
Swt1 T A 1: 151,410,943 E266V probably damaging Het
Tbc1d9 A G 8: 83,261,121 D903G probably damaging Het
Tbx18 A T 9: 87,729,482 M165K probably damaging Het
Tmem25 T C 9: 44,795,502 N282S probably damaging Het
Tom1l2 T C 11: 60,262,730 I140M probably benign Het
Trak2 A G 1: 58,903,899 S783P probably damaging Het
Trpv4 G A 5: 114,630,007 T534M probably benign Het
Ttc6 G T 12: 57,575,944 R43M probably damaging Het
Vmn1r194 A G 13: 22,244,705 Y164C probably benign Het
Vmn1r228 T C 17: 20,776,761 Y165C probably benign Het
Vps13b C A 15: 35,846,913 T2614K probably damaging Het
Zdhhc14 T C 17: 5,647,962 F102S probably benign Het
Zyg11b A G 4: 108,250,817 M464T probably benign Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGGCAGTGATGAGACC -3'
(R):5'- TAAGGGTAAGCAAGGCTCCG -3'

Sequencing Primer
(F):5'- GATGACAATAGCTGTTACGTCAG -3'
(R):5'- AAGGCCCTGGAGGTTAGGTTC -3'
Posted On 2022-03-25