Incidental Mutation 'R9291:Otud4'
ID 704284
Institutional Source Beutler Lab
Gene Symbol Otud4
Ensembl Gene ENSMUSG00000036990
Gene Name OTU domain containing 4
Synonyms 4930431L18Rik, D8Ertd69e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock # R9291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 79639618-79677724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79646323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 90 (Y90C)
Ref Sequence ENSEMBL: ENSMUSP00000133939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173078] [ENSMUST00000173286]
AlphaFold B2RRE7
Predicted Effect probably damaging
Transcript: ENSMUST00000173078
AA Change: Y90C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133939
Gene: ENSMUSG00000036990
AA Change: Y90C

DomainStartEndE-ValueType
Pfam:OTU 40 154 3.4e-17 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 335 2e-7 BLAST
low complexity region 392 405 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1082 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173286
AA Change: Y90C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134097
Gene: ENSMUSG00000036990
AA Change: Y90C

DomainStartEndE-ValueType
Pfam:OTU 40 149 5.3e-21 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 334 9e-9 BLAST
low complexity region 391 404 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1081 1103 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,703 N551S probably benign Het
Abcg5 C A 17: 84,668,952 V486L probably benign Het
Acoxl T A 2: 127,972,573 I303N probably damaging Het
Atp6v1h G T 1: 5,150,061 W464L probably null Het
Cdcp2 A G 4: 107,106,856 D301G probably damaging Het
Cenpv T C 11: 62,538,862 D115G probably benign Het
Cnfn T C 7: 25,368,051 D67G possibly damaging Het
Col27a1 A C 4: 63,224,302 I76L probably damaging Het
Crb2 G A 2: 37,792,201 V865I probably damaging Het
Ctf1 T A 7: 127,717,032 L58Q probably damaging Het
Dennd6b C T 15: 89,187,387 V276M possibly damaging Het
Dis3l2 A G 1: 86,973,493 T483A possibly damaging Het
Dlg5 T C 14: 24,191,161 T223A probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah8 T C 17: 30,725,125 I1772T probably damaging Het
Dscaml1 T C 9: 45,447,953 I170T probably damaging Het
Ehd4 G T 2: 120,091,274 D500E probably damaging Het
Elac2 T C 11: 64,992,316 I388T probably damaging Het
Entpd6 G A 2: 150,767,039 V348M probably benign Het
Epg5 T A 18: 78,012,850 C1746* probably null Het
Exosc2 G T 2: 31,670,859 M40I probably benign Het
Fam193a T C 5: 34,436,491 Y27H probably damaging Het
Gm13084 A T 4: 143,812,681 Y81N probably benign Het
Gm8005 A G 14: 42,436,928 F148L Het
Hectd4 T C 5: 121,348,965 V3341A probably benign Het
Hecw1 A G 13: 14,316,937 V77A probably benign Het
Irf2bp1 T A 7: 19,004,533 C33S probably damaging Het
Kank4 A T 4: 98,778,451 H586Q probably benign Het
Kcnu1 A G 8: 25,900,013 N619S probably benign Het
Kndc1 A G 7: 139,895,224 E13G possibly damaging Het
Lrp2 A T 2: 69,480,035 D2731E probably damaging Het
Lyst A G 13: 13,709,353 N2942S probably benign Het
Maml3 G A 3: 51,856,907 T212M probably benign Het
Mill2 T C 7: 18,841,491 V41A probably benign Het
Moxd2 C A 6: 40,880,428 C466F probably damaging Het
Nefh A G 11: 4,940,871 S583P probably benign Het
Nlrp9b T A 7: 20,024,586 S583T possibly damaging Het
Nup214 T G 2: 31,977,794 M91R probably benign Het
Olfr1055 A T 2: 86,347,424 I114N probably benign Het
Olfr1226 A C 2: 89,193,794 M80R possibly damaging Het
Olfr776 T C 10: 129,261,333 I124T probably damaging Het
Papln C A 12: 83,778,510 T575N probably benign Het
Pkhd1l1 T A 15: 44,569,976 N3417K probably damaging Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Rchy1 A G 5: 91,951,906 L191S possibly damaging Het
Rims1 T C 1: 22,397,522 D296G Het
Sftpb T A 6: 72,309,897 C261* probably null Het
Sgcd C T 11: 46,979,339 C265Y probably damaging Het
Slc44a5 G A 3: 154,256,581 V384M possibly damaging Het
Slx4ip T A 2: 137,046,796 N132K probably benign Het
Sspo C T 6: 48,496,396 T4861M probably damaging Het
Swt1 T A 1: 151,410,943 E266V probably damaging Het
Tbc1d9 A G 8: 83,261,121 D903G probably damaging Het
Tbx18 A T 9: 87,729,482 M165K probably damaging Het
Tmem25 T C 9: 44,795,502 N282S probably damaging Het
Tom1l2 T C 11: 60,262,730 I140M probably benign Het
Trak2 A G 1: 58,903,899 S783P probably damaging Het
Trpv4 G A 5: 114,630,007 T534M probably benign Het
Ttc6 G T 12: 57,575,944 R43M probably damaging Het
Vmn1r194 A G 13: 22,244,705 Y164C probably benign Het
Vmn1r228 T C 17: 20,776,761 Y165C probably benign Het
Vps13b C A 15: 35,846,913 T2614K probably damaging Het
Zdhhc14 T C 17: 5,647,962 F102S probably benign Het
Zyg11b A G 4: 108,250,817 M464T probably benign Het
Other mutations in Otud4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Otud4 APN 8 79672881 missense probably damaging 0.99
IGL01353:Otud4 APN 8 79665021 missense probably benign
IGL01371:Otud4 APN 8 79673761 missense probably damaging 1.00
IGL01782:Otud4 APN 8 79673011 missense possibly damaging 0.95
IGL01912:Otud4 APN 8 79673837 missense probably benign
IGL02294:Otud4 APN 8 79664977 splice site probably benign
IGL02830:Otud4 APN 8 79673301 missense probably benign 0.00
IGL03063:Otud4 APN 8 79663790 missense probably benign 0.01
IGL03077:Otud4 APN 8 79673458 missense probably damaging 0.97
R0437:Otud4 UTSW 8 79669997 missense probably benign 0.02
R1024:Otud4 UTSW 8 79664093 missense probably benign 0.01
R1118:Otud4 UTSW 8 79653351 splice site probably benign
R1296:Otud4 UTSW 8 79673974 missense unknown
R1321:Otud4 UTSW 8 79669950 missense probably benign 0.03
R1674:Otud4 UTSW 8 79673147 missense probably benign 0.12
R1736:Otud4 UTSW 8 79651665 splice site probably benign
R1815:Otud4 UTSW 8 79639989 nonsense probably null
R1950:Otud4 UTSW 8 79646332 missense probably damaging 0.99
R1985:Otud4 UTSW 8 79640012 missense probably damaging 1.00
R2173:Otud4 UTSW 8 79668464 missense probably damaging 1.00
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2907:Otud4 UTSW 8 79673068 missense probably benign 0.02
R3545:Otud4 UTSW 8 79665055 missense probably damaging 1.00
R4628:Otud4 UTSW 8 79639968 missense possibly damaging 0.73
R4790:Otud4 UTSW 8 79666773 missense possibly damaging 0.82
R4989:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5133:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5134:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5294:Otud4 UTSW 8 79672892 missense possibly damaging 0.54
R5410:Otud4 UTSW 8 79672997 missense probably benign 0.04
R5454:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R5579:Otud4 UTSW 8 79664108 missense probably benign
R5738:Otud4 UTSW 8 79673461 missense probably benign 0.02
R5886:Otud4 UTSW 8 79672807 missense probably damaging 1.00
R6062:Otud4 UTSW 8 79673896 missense probably damaging 1.00
R6364:Otud4 UTSW 8 79646341 missense probably damaging 0.99
R6427:Otud4 UTSW 8 79668497 missense probably benign 0.00
R6450:Otud4 UTSW 8 79672997 missense probably benign 0.04
R6744:Otud4 UTSW 8 79673778 nonsense probably null
R6773:Otud4 UTSW 8 79643806 missense possibly damaging 0.95
R7046:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R7142:Otud4 UTSW 8 79672762 splice site probably null
R7420:Otud4 UTSW 8 79664108 missense probably benign 0.11
R7470:Otud4 UTSW 8 79673360 missense probably benign 0.00
R7670:Otud4 UTSW 8 79655864 splice site probably null
R7736:Otud4 UTSW 8 79655765 missense possibly damaging 0.53
R8229:Otud4 UTSW 8 79673975 missense unknown
R8397:Otud4 UTSW 8 79669298 missense probably benign 0.06
R8520:Otud4 UTSW 8 79659267 missense probably damaging 1.00
R9041:Otud4 UTSW 8 79673812 missense probably damaging 0.98
R9495:Otud4 UTSW 8 79673458 missense probably damaging 1.00
R9502:Otud4 UTSW 8 79673851 missense probably benign 0.01
X0024:Otud4 UTSW 8 79646310 missense probably benign 0.01
Z1176:Otud4 UTSW 8 79658929 missense probably benign
Z1177:Otud4 UTSW 8 79643811 nonsense probably null
Z1177:Otud4 UTSW 8 79643812 missense probably damaging 0.99
Z1177:Otud4 UTSW 8 79665027 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGTAAATCTGTTGCTGCTTGGC -3'
(R):5'- GCTACATTCATATGCCATGACAAAC -3'

Sequencing Primer
(F):5'- CTGCTTGGCATATTTCTTAGACAG -3'
(R):5'- ACTAGCTCTGTAGACCAGACTGG -3'
Posted On 2022-03-25