Incidental Mutation 'R9291:Papln'
ID 704296
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Name papilin, proteoglycan-like sulfated glycoprotein
Synonyms E030033C16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9291 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 83763634-83792382 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 83778510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 575 (T575N)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
AlphaFold Q9EPX2
Predicted Effect probably benign
Transcript: ENSMUST00000021646
AA Change: T553N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: T553N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121733
AA Change: T575N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: T575N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,703 N551S probably benign Het
Abcg5 C A 17: 84,668,952 V486L probably benign Het
Acoxl T A 2: 127,972,573 I303N probably damaging Het
Atp6v1h G T 1: 5,150,061 W464L probably null Het
Cdcp2 A G 4: 107,106,856 D301G probably damaging Het
Cenpv T C 11: 62,538,862 D115G probably benign Het
Cnfn T C 7: 25,368,051 D67G possibly damaging Het
Col27a1 A C 4: 63,224,302 I76L probably damaging Het
Crb2 G A 2: 37,792,201 V865I probably damaging Het
Ctf1 T A 7: 127,717,032 L58Q probably damaging Het
Dennd6b C T 15: 89,187,387 V276M possibly damaging Het
Dis3l2 A G 1: 86,973,493 T483A possibly damaging Het
Dlg5 T C 14: 24,191,161 T223A probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dnah8 T C 17: 30,725,125 I1772T probably damaging Het
Dscaml1 T C 9: 45,447,953 I170T probably damaging Het
Ehd4 G T 2: 120,091,274 D500E probably damaging Het
Elac2 T C 11: 64,992,316 I388T probably damaging Het
Entpd6 G A 2: 150,767,039 V348M probably benign Het
Epg5 T A 18: 78,012,850 C1746* probably null Het
Exosc2 G T 2: 31,670,859 M40I probably benign Het
Fam193a T C 5: 34,436,491 Y27H probably damaging Het
Gm13084 A T 4: 143,812,681 Y81N probably benign Het
Gm8005 A G 14: 42,436,928 F148L Het
Hectd4 T C 5: 121,348,965 V3341A probably benign Het
Hecw1 A G 13: 14,316,937 V77A probably benign Het
Irf2bp1 T A 7: 19,004,533 C33S probably damaging Het
Kank4 A T 4: 98,778,451 H586Q probably benign Het
Kcnu1 A G 8: 25,900,013 N619S probably benign Het
Kndc1 A G 7: 139,895,224 E13G possibly damaging Het
Lrp2 A T 2: 69,480,035 D2731E probably damaging Het
Lyst A G 13: 13,709,353 N2942S probably benign Het
Maml3 G A 3: 51,856,907 T212M probably benign Het
Mill2 T C 7: 18,841,491 V41A probably benign Het
Moxd2 C A 6: 40,880,428 C466F probably damaging Het
Nefh A G 11: 4,940,871 S583P probably benign Het
Nlrp9b T A 7: 20,024,586 S583T possibly damaging Het
Nup214 T G 2: 31,977,794 M91R probably benign Het
Olfr1055 A T 2: 86,347,424 I114N probably benign Het
Olfr1226 A C 2: 89,193,794 M80R possibly damaging Het
Olfr776 T C 10: 129,261,333 I124T probably damaging Het
Otud4 A G 8: 79,646,323 Y90C probably damaging Het
Pkhd1l1 T A 15: 44,569,976 N3417K probably damaging Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Rchy1 A G 5: 91,951,906 L191S possibly damaging Het
Rims1 T C 1: 22,397,522 D296G Het
Sftpb T A 6: 72,309,897 C261* probably null Het
Sgcd C T 11: 46,979,339 C265Y probably damaging Het
Slc44a5 G A 3: 154,256,581 V384M possibly damaging Het
Slx4ip T A 2: 137,046,796 N132K probably benign Het
Sspo C T 6: 48,496,396 T4861M probably damaging Het
Swt1 T A 1: 151,410,943 E266V probably damaging Het
Tbc1d9 A G 8: 83,261,121 D903G probably damaging Het
Tbx18 A T 9: 87,729,482 M165K probably damaging Het
Tmem25 T C 9: 44,795,502 N282S probably damaging Het
Tom1l2 T C 11: 60,262,730 I140M probably benign Het
Trak2 A G 1: 58,903,899 S783P probably damaging Het
Trpv4 G A 5: 114,630,007 T534M probably benign Het
Ttc6 G T 12: 57,575,944 R43M probably damaging Het
Vmn1r194 A G 13: 22,244,705 Y164C probably benign Het
Vmn1r228 T C 17: 20,776,761 Y165C probably benign Het
Vps13b C A 15: 35,846,913 T2614K probably damaging Het
Zdhhc14 T C 17: 5,647,962 F102S probably benign Het
Zyg11b A G 4: 108,250,817 M464T probably benign Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83770436 missense possibly damaging 0.81
IGL01788:Papln APN 12 83775462 missense probably benign 0.32
IGL01889:Papln APN 12 83786835 missense probably benign 0.25
IGL02499:Papln APN 12 83780671 missense probably benign 0.00
IGL02567:Papln APN 12 83778837 missense probably benign 0.00
IGL03150:Papln APN 12 83782984 missense probably damaging 1.00
IGL03331:Papln APN 12 83783661 missense probably benign
F5770:Papln UTSW 12 83778834 missense possibly damaging 0.72
R0201:Papln UTSW 12 83783027 splice site probably benign
R0389:Papln UTSW 12 83783379 nonsense probably null
R0763:Papln UTSW 12 83791865 missense possibly damaging 0.54
R1508:Papln UTSW 12 83782916 missense probably damaging 0.99
R1628:Papln UTSW 12 83784406 splice site probably benign
R1920:Papln UTSW 12 83789254 nonsense probably null
R1974:Papln UTSW 12 83782037 missense probably damaging 0.98
R2004:Papln UTSW 12 83773218 missense probably damaging 1.00
R2105:Papln UTSW 12 83780236 missense probably benign 0.04
R2876:Papln UTSW 12 83778927 missense probably damaging 0.96
R4199:Papln UTSW 12 83783392 missense probably null 0.01
R4702:Papln UTSW 12 83781983 missense probably benign 0.01
R4705:Papln UTSW 12 83777208 splice site probably null
R4835:Papln UTSW 12 83774420 missense probably damaging 0.99
R4874:Papln UTSW 12 83777143 missense probably benign 0.01
R4938:Papln UTSW 12 83782903 missense probably benign 0.35
R5000:Papln UTSW 12 83774889 missense probably damaging 1.00
R5149:Papln UTSW 12 83771882 splice site probably null
R5324:Papln UTSW 12 83774571 missense probably damaging 1.00
R5784:Papln UTSW 12 83781980 missense probably benign
R5881:Papln UTSW 12 83771878 missense probably null 0.91
R5977:Papln UTSW 12 83784369 nonsense probably null
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6291:Papln UTSW 12 83783015 missense probably benign 0.01
R6461:Papln UTSW 12 83781813 splice site probably null
R6536:Papln UTSW 12 83781887 missense probably damaging 1.00
R6861:Papln UTSW 12 83774949 missense probably damaging 1.00
R6898:Papln UTSW 12 83777460 missense probably benign 0.03
R6953:Papln UTSW 12 83781885 nonsense probably null
R7155:Papln UTSW 12 83776521 missense probably damaging 1.00
R7450:Papln UTSW 12 83780171 missense probably benign 0.13
R7510:Papln UTSW 12 83772173 missense probably damaging 0.99
R7850:Papln UTSW 12 83780662 missense probably damaging 1.00
R7977:Papln UTSW 12 83775382 missense probably damaging 1.00
R7987:Papln UTSW 12 83775382 missense probably damaging 1.00
R8321:Papln UTSW 12 83774941 nonsense probably null
R8324:Papln UTSW 12 83786619 missense probably damaging 1.00
R8466:Papln UTSW 12 83778481 critical splice acceptor site probably null
R8743:Papln UTSW 12 83782990 missense probably damaging 1.00
R8790:Papln UTSW 12 83777144 missense probably benign 0.01
R9086:Papln UTSW 12 83774859 missense probably damaging 1.00
R9350:Papln UTSW 12 83786864 missense probably damaging 1.00
R9438:Papln UTSW 12 83771832 missense probably benign
R9484:Papln UTSW 12 83791844 missense probably benign 0.05
V7580:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7581:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7582:Papln UTSW 12 83778834 missense possibly damaging 0.72
Z1088:Papln UTSW 12 83776376 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTCTAACAGGACTTAGTTTTGC -3'
(R):5'- CCACTGTGATGTACCAACGC -3'

Sequencing Primer
(F):5'- CTGCAGAAAATCTTGGAGCC -3'
(R):5'- GTGATGTACCAACGCCCCTC -3'
Posted On 2022-03-25