Incidental Mutation 'R9292:Coq10b'
ID 704312
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R9292 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55110868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 212 (M212K)
Ref Sequence ENSEMBL: ENSMUSP00000027125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027125
AA Change: M212K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981
AA Change: M212K

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087617
AA Change: M162K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981
AA Change: M162K

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,862,843 (GRCm39) T175I probably benign Het
Acat3 T C 17: 13,146,255 (GRCm39) T243A probably benign Het
Aebp1 C A 11: 5,815,260 (GRCm39) P264Q possibly damaging Het
Aldh1l1 T C 6: 90,568,867 (GRCm39) F723L probably damaging Het
Atp13a4 T A 16: 29,241,500 (GRCm39) I723F Het
Bop1 T C 15: 76,351,031 (GRCm39) T97A probably benign Het
Casq1 T C 1: 172,043,114 (GRCm39) Y194C probably damaging Het
Cep250 G A 2: 155,832,688 (GRCm39) E1538K probably damaging Het
Col12a1 A T 9: 79,585,805 (GRCm39) V1218E probably benign Het
Dchs1 T C 7: 105,403,120 (GRCm39) T3141A probably damaging Het
Dnajc10 A G 2: 80,176,916 (GRCm39) T624A probably benign Het
Dock8 A G 19: 25,160,995 (GRCm39) probably benign Het
Dsg1c T A 18: 20,416,775 (GRCm39) V892E probably damaging Het
Eif4g3 A G 4: 137,921,382 (GRCm39) R1370G possibly damaging Het
Elmo1 T G 13: 20,784,429 (GRCm39) probably null Het
Erc2 T A 14: 27,498,799 (GRCm39) I225N probably damaging Het
Ermp1 C A 19: 29,606,049 (GRCm39) V422L probably benign Het
Fam124b T A 1: 80,191,221 (GRCm39) H54L probably benign Het
Gabbr1 T G 17: 37,366,784 (GRCm39) I336S possibly damaging Het
Galk2 T C 2: 125,817,218 (GRCm39) Y336H probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Grm4 A G 17: 27,692,037 (GRCm39) F194S probably damaging Het
Gtf2a1 G A 12: 91,534,964 (GRCm39) Q189* probably null Het
Gtf3c1 T C 7: 125,273,563 (GRCm39) probably benign Het
Hspa2 A G 12: 76,452,047 (GRCm39) E247G probably damaging Het
Lpar1 T C 4: 58,486,558 (GRCm39) R238G probably benign Het
Ltbp1 C A 17: 75,583,436 (GRCm39) S412Y probably damaging Het
Nup210 A C 6: 91,051,235 (GRCm39) S383A possibly damaging Het
Or10j3 C T 1: 173,031,099 (GRCm39) P59S probably damaging Het
Or11g2 T C 14: 50,856,513 (GRCm39) V278A possibly damaging Het
Or8b51 T A 9: 38,569,071 (GRCm39) N206Y probably damaging Het
Pah T A 10: 87,403,218 (GRCm39) Y198N probably damaging Het
Pcdhga4 A T 18: 37,819,713 (GRCm39) I421L probably benign Het
Pde6b T C 5: 108,536,751 (GRCm39) I149T probably benign Het
Peli3 G A 19: 4,988,117 (GRCm39) P81L possibly damaging Het
Pfdn5 T C 15: 102,234,883 (GRCm39) S30P possibly damaging Het
Plcb3 A T 19: 6,942,042 (GRCm39) L263Q probably damaging Het
Pld3 T C 7: 27,238,879 (GRCm39) M190V probably benign Het
Rab6a A G 7: 100,285,963 (GRCm39) E186G probably benign Het
Ralyl T A 3: 14,172,312 (GRCm39) D60E probably benign Het
Rtl1 G A 12: 109,556,673 (GRCm39) A1722V possibly damaging Het
Scarf1 T C 11: 75,406,006 (GRCm39) Y97H probably damaging Het
Sf3a2 T A 10: 80,640,560 (GRCm39) V457E unknown Het
Sh2d4b C G 14: 40,537,914 (GRCm39) E403Q probably damaging Het
Slc12a7 A G 13: 73,932,707 (GRCm39) E65G possibly damaging Het
Spink5 T C 18: 44,148,075 (GRCm39) V905A possibly damaging Het
Spred1 T C 2: 117,005,832 (GRCm39) F198S probably benign Het
St18 C A 1: 6,898,106 (GRCm39) T636K probably benign Het
Stag3 T A 5: 138,299,712 (GRCm39) D874E probably benign Het
Suco T C 1: 161,671,574 (GRCm39) T502A probably damaging Het
Swt1 T C 1: 151,278,787 (GRCm39) I457V probably benign Het
Syne2 G T 12: 75,997,823 (GRCm39) C2266F probably benign Het
Tcirg1 T C 19: 3,947,840 (GRCm39) N532D probably damaging Het
Tfdp1 T A 8: 13,420,580 (GRCm39) N136K probably benign Het
Tmem245 T C 4: 56,926,173 (GRCm39) probably benign Het
Tmem245 T C 4: 56,937,979 (GRCm39) I190V probably benign Het
Trp53bp1 C T 2: 121,046,177 (GRCm39) V1208M probably damaging Het
Tulp1 T A 17: 28,582,738 (GRCm39) K137* probably null Het
Zfp534 A T 4: 147,759,095 (GRCm39) C525S probably damaging Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1517:Coq10b UTSW 1 55,103,416 (GRCm39) missense probably damaging 1.00
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R1767:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2195:Coq10b UTSW 1 55,100,457 (GRCm39) missense probably damaging 1.00
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5367:Coq10b UTSW 1 55,092,143 (GRCm39) missense probably benign
R5534:Coq10b UTSW 1 55,103,359 (GRCm39) missense possibly damaging 0.83
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7836:Coq10b UTSW 1 55,092,013 (GRCm39) start gained probably benign
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTCCAAGTAACTGGACCTCG -3'
(R):5'- TCAACAGATGGTAAAAGGACTTCC -3'

Sequencing Primer
(F):5'- ATACTAGGCTAGTGGTGAATCCCC -3'
(R):5'- TTCCTAGAAGTGAACAAACTAGCC -3'
Posted On 2022-03-25