Mutagenetix > Incidental Mutation

Incidental Mutation 'R9292:Spink5'

704363

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44015008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 905 (V905A)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

AlphaFold

Q148R4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069245
AA Change: V905A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: V905A

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	C	T	5: 8,812,843	T175I	probably benign	Het
Acat3	T	C	17: 12,927,368	T243A	probably benign	Het
Aebp1	C	A	11: 5,865,260	P264Q	possibly damaging	Het
Aldh1l1	T	C	6: 90,591,885	F723L	probably damaging	Het
Atp13a4	T	A	16: 29,422,682	I723F		Het
Bop1	T	C	15: 76,466,831	T97A	probably benign	Het
Casq1	T	C	1: 172,215,547	Y194C	probably damaging	Het
Cep250	G	A	2: 155,990,768	E1538K	probably damaging	Het
Col12a1	A	T	9: 79,678,523	V1218E	probably benign	Het
Coq10b	T	A	1: 55,071,709	M212K	probably damaging	Het
Dchs1	T	C	7: 105,753,913	T3141A	probably damaging	Het
Dnajc10	A	G	2: 80,346,572	T624A	probably benign	Het
Dock8	A	G	19: 25,183,631		probably benign	Het
Dsg1c	T	A	18: 20,283,718	V892E	probably damaging	Het
Eif4g3	A	G	4: 138,194,071	R1370G	possibly damaging	Het
Elmo1	T	G	13: 20,600,259		probably null	Het
Erc2	T	A	14: 27,776,842	I225N	probably damaging	Het
Ermp1	C	A	19: 29,628,649	V422L	probably benign	Het
Fam124b	T	A	1: 80,213,504	H54L	probably benign	Het
Gabbr1	T	G	17: 37,055,892	I336S	possibly damaging	Het
Galk2	T	C	2: 125,975,298	Y336H	probably damaging	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Grm4	A	G	17: 27,473,063	F194S	probably damaging	Het
Gtf2a1	G	A	12: 91,568,190	Q189*	probably null	Het
Gtf3c1	T	C	7: 125,674,391		probably benign	Het
Hspa2	A	G	12: 76,405,273	E247G	probably damaging	Het
Lpar1	T	C	4: 58,486,558	R238G	probably benign	Het
Ltbp1	C	A	17: 75,276,441	S412Y	probably damaging	Het
Nup210	A	C	6: 91,074,253	S383A	possibly damaging	Het
Olfr218	C	T	1: 173,203,532	P59S	probably damaging	Het
Olfr744	T	C	14: 50,619,056	V278A	possibly damaging	Het
Olfr916	T	A	9: 38,657,775	N206Y	probably damaging	Het
Pah	T	A	10: 87,567,356	Y198N	probably damaging	Het
Pcdhga4	A	T	18: 37,686,660	I421L	probably benign	Het
Pde6b	T	C	5: 108,388,885	I149T	probably benign	Het
Peli3	G	A	19: 4,938,089	P81L	possibly damaging	Het
Pfdn5	T	C	15: 102,326,448	S30P	possibly damaging	Het
Plcb3	A	T	19: 6,964,674	L263Q	probably damaging	Het
Pld3	T	C	7: 27,539,454	M190V	probably benign	Het
Rab6a	A	G	7: 100,636,756	E186G	probably benign	Het
Ralyl	T	A	3: 14,107,252	D60E	probably benign	Het
Rtl1	G	A	12: 109,590,239	A1722V	possibly damaging	Het
Scarf1	T	C	11: 75,515,180	Y97H	probably damaging	Het
Sf3a2	T	A	10: 80,804,726	V457E	unknown	Het
Sh2d4b	C	G	14: 40,815,957	E403Q	probably damaging	Het
Slc12a7	A	G	13: 73,784,588	E65G	possibly damaging	Het
Spred1	T	C	2: 117,175,351	F198S	probably benign	Het
St18	C	A	1: 6,827,882	T636K	probably benign	Het
Stag3	T	A	5: 138,301,450	D874E	probably benign	Het
Suco	T	C	1: 161,844,005	T502A	probably damaging	Het
Swt1	T	C	1: 151,403,036	I457V	probably benign	Het
Syne2	G	T	12: 75,951,049	C2266F	probably benign	Het
Tcirg1	T	C	19: 3,897,840	N532D	probably damaging	Het
Tfdp1	T	A	8: 13,370,580	N136K	probably benign	Het
Tmem245	T	C	4: 56,937,979	I190V	probably benign	Het
Tmem245	T	C	4: 56,926,173		probably benign	Het
Trp53bp1	C	T	2: 121,215,696	V1208M	probably damaging	Het
Tulp1	T	A	17: 28,363,764	K137*	probably null	Het
Zfp534	A	T	4: 147,674,638	C525S	probably damaging	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999934	splice site	probably benign
R0079:Spink5	UTSW	18	43977764	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	43990672	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7332:Spink5	UTSW	18	43982250	missense	probably damaging	0.96
R7396:Spink5	UTSW	18	43977655	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44010236	missense	probably benign	0.07
R8198:Spink5	UTSW	18	43992880	missense	probably benign	0.17
R8361:Spink5	UTSW	18	43989462	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	43990719	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44010238	missense	probably benign	0.02
R8749:Spink5	UTSW	18	43989358	nonsense	probably null
R8918:Spink5	UTSW	18	43967020	missense	probably damaging	0.98
R9064:Spink5	UTSW	18	43967126	missense	probably damaging	1.00
R9161:Spink5	UTSW	18	44014919	missense	probably damaging	1.00
R9221:Spink5	UTSW	18	43986300	missense	probably damaging	1.00
R9545:Spink5	UTSW	18	44003195	missense	possibly damaging	0.88
R9784:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCGAGTTTGAGAAAACCACC -3'
(R):5'- TTTGGAATGAGCACCCTGATAAG -3'

Sequencing Primer
(F):5'- CATCAACAAAGGAAAAGCTTATGC -3'
(R):5'- TGGAATGAGCACCCTGATAAGAATAC -3'

Posted On

2022-03-25