Incidental Mutation 'R9292:Spink5'
ID 704363
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms 2310065D10Rik, LEKT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9292 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43963235-44022501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44015008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 905 (V905A)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect possibly damaging
Transcript: ENSMUST00000069245
AA Change: V905A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: V905A

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,812,843 T175I probably benign Het
Acat3 T C 17: 12,927,368 T243A probably benign Het
Aebp1 C A 11: 5,865,260 P264Q possibly damaging Het
Aldh1l1 T C 6: 90,591,885 F723L probably damaging Het
Atp13a4 T A 16: 29,422,682 I723F Het
Bop1 T C 15: 76,466,831 T97A probably benign Het
Casq1 T C 1: 172,215,547 Y194C probably damaging Het
Cep250 G A 2: 155,990,768 E1538K probably damaging Het
Col12a1 A T 9: 79,678,523 V1218E probably benign Het
Coq10b T A 1: 55,071,709 M212K probably damaging Het
Dchs1 T C 7: 105,753,913 T3141A probably damaging Het
Dnajc10 A G 2: 80,346,572 T624A probably benign Het
Dsg1c T A 18: 20,283,718 V892E probably damaging Het
Eif4g3 A G 4: 138,194,071 R1370G possibly damaging Het
Elmo1 T G 13: 20,600,259 probably null Het
Erc2 T A 14: 27,776,842 I225N probably damaging Het
Ermp1 C A 19: 29,628,649 V422L probably benign Het
Fam124b T A 1: 80,213,504 H54L probably benign Het
Gabbr1 T G 17: 37,055,892 I336S possibly damaging Het
Galk2 T C 2: 125,975,298 Y336H probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grm4 A G 17: 27,473,063 F194S probably damaging Het
Gtf2a1 G A 12: 91,568,190 Q189* probably null Het
Hspa2 A G 12: 76,405,273 E247G probably damaging Het
Lpar1 T C 4: 58,486,558 R238G probably benign Het
Ltbp1 C A 17: 75,276,441 S412Y probably damaging Het
Nup210 A C 6: 91,074,253 S383A possibly damaging Het
Olfr218 C T 1: 173,203,532 P59S probably damaging Het
Olfr744 T C 14: 50,619,056 V278A possibly damaging Het
Olfr916 T A 9: 38,657,775 N206Y probably damaging Het
Pah T A 10: 87,567,356 Y198N probably damaging Het
Pcdhga4 A T 18: 37,686,660 I421L probably benign Het
Pde6b T C 5: 108,388,885 I149T probably benign Het
Peli3 G A 19: 4,938,089 P81L possibly damaging Het
Pfdn5 T C 15: 102,326,448 S30P possibly damaging Het
Plcb3 A T 19: 6,964,674 L263Q probably damaging Het
Pld3 T C 7: 27,539,454 M190V probably benign Het
Rab6a A G 7: 100,636,756 E186G probably benign Het
Ralyl T A 3: 14,107,252 D60E probably benign Het
Rtl1 G A 12: 109,590,239 A1722V possibly damaging Het
Scarf1 T C 11: 75,515,180 Y97H probably damaging Het
Sf3a2 T A 10: 80,804,726 V457E unknown Het
Sh2d4b C G 14: 40,815,957 E403Q probably damaging Het
Slc12a7 A G 13: 73,784,588 E65G possibly damaging Het
Spred1 T C 2: 117,175,351 F198S probably benign Het
St18 C A 1: 6,827,882 T636K probably benign Het
Stag3 T A 5: 138,301,450 D874E probably benign Het
Suco T C 1: 161,844,005 T502A probably damaging Het
Swt1 T C 1: 151,403,036 I457V probably benign Het
Syne2 G T 12: 75,951,049 C2266F probably benign Het
Tcirg1 T C 19: 3,897,840 N532D probably damaging Het
Tfdp1 T A 8: 13,370,580 N136K probably benign Het
Tmem245 T C 4: 56,937,979 I190V probably benign Het
Trp53bp1 C T 2: 121,215,696 V1208M probably damaging Het
Tulp1 T A 17: 28,363,764 K137* probably null Het
Zfp534 A T 4: 147,674,638 C525S probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
R8198:Spink5 UTSW 18 43992880 missense probably benign 0.17
R8361:Spink5 UTSW 18 43989462 missense probably damaging 1.00
R8375:Spink5 UTSW 18 43990719 missense probably benign 0.01
R8684:Spink5 UTSW 18 44010238 missense probably benign 0.02
R8749:Spink5 UTSW 18 43989358 nonsense probably null
R8918:Spink5 UTSW 18 43967020 missense probably damaging 0.98
R9064:Spink5 UTSW 18 43967126 missense probably damaging 1.00
R9161:Spink5 UTSW 18 44014919 missense probably damaging 1.00
R9221:Spink5 UTSW 18 43986300 missense probably damaging 1.00
R9545:Spink5 UTSW 18 44003195 missense possibly damaging 0.88
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGAGTTTGAGAAAACCACC -3'
(R):5'- TTTGGAATGAGCACCCTGATAAG -3'

Sequencing Primer
(F):5'- CATCAACAAAGGAAAAGCTTATGC -3'
(R):5'- TGGAATGAGCACCCTGATAAGAATAC -3'
Posted On 2022-03-25