Incidental Mutation 'R9292:Spink5'
ID 704363
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms LEKT1, 2310065D10Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9292 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 44096302-44155568 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44148075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 905 (V905A)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect possibly damaging
Transcript: ENSMUST00000069245
AA Change: V905A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: V905A

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,862,843 (GRCm39) T175I probably benign Het
Acat3 T C 17: 13,146,255 (GRCm39) T243A probably benign Het
Aebp1 C A 11: 5,815,260 (GRCm39) P264Q possibly damaging Het
Aldh1l1 T C 6: 90,568,867 (GRCm39) F723L probably damaging Het
Atp13a4 T A 16: 29,241,500 (GRCm39) I723F Het
Bop1 T C 15: 76,351,031 (GRCm39) T97A probably benign Het
Casq1 T C 1: 172,043,114 (GRCm39) Y194C probably damaging Het
Cep250 G A 2: 155,832,688 (GRCm39) E1538K probably damaging Het
Col12a1 A T 9: 79,585,805 (GRCm39) V1218E probably benign Het
Coq10b T A 1: 55,110,868 (GRCm39) M212K probably damaging Het
Dchs1 T C 7: 105,403,120 (GRCm39) T3141A probably damaging Het
Dnajc10 A G 2: 80,176,916 (GRCm39) T624A probably benign Het
Dock8 A G 19: 25,160,995 (GRCm39) probably benign Het
Dsg1c T A 18: 20,416,775 (GRCm39) V892E probably damaging Het
Eif4g3 A G 4: 137,921,382 (GRCm39) R1370G possibly damaging Het
Elmo1 T G 13: 20,784,429 (GRCm39) probably null Het
Erc2 T A 14: 27,498,799 (GRCm39) I225N probably damaging Het
Ermp1 C A 19: 29,606,049 (GRCm39) V422L probably benign Het
Fam124b T A 1: 80,191,221 (GRCm39) H54L probably benign Het
Gabbr1 T G 17: 37,366,784 (GRCm39) I336S possibly damaging Het
Galk2 T C 2: 125,817,218 (GRCm39) Y336H probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Grm4 A G 17: 27,692,037 (GRCm39) F194S probably damaging Het
Gtf2a1 G A 12: 91,534,964 (GRCm39) Q189* probably null Het
Gtf3c1 T C 7: 125,273,563 (GRCm39) probably benign Het
Hspa2 A G 12: 76,452,047 (GRCm39) E247G probably damaging Het
Lpar1 T C 4: 58,486,558 (GRCm39) R238G probably benign Het
Ltbp1 C A 17: 75,583,436 (GRCm39) S412Y probably damaging Het
Nup210 A C 6: 91,051,235 (GRCm39) S383A possibly damaging Het
Or10j3 C T 1: 173,031,099 (GRCm39) P59S probably damaging Het
Or11g2 T C 14: 50,856,513 (GRCm39) V278A possibly damaging Het
Or8b51 T A 9: 38,569,071 (GRCm39) N206Y probably damaging Het
Pah T A 10: 87,403,218 (GRCm39) Y198N probably damaging Het
Pcdhga4 A T 18: 37,819,713 (GRCm39) I421L probably benign Het
Pde6b T C 5: 108,536,751 (GRCm39) I149T probably benign Het
Peli3 G A 19: 4,988,117 (GRCm39) P81L possibly damaging Het
Pfdn5 T C 15: 102,234,883 (GRCm39) S30P possibly damaging Het
Plcb3 A T 19: 6,942,042 (GRCm39) L263Q probably damaging Het
Pld3 T C 7: 27,238,879 (GRCm39) M190V probably benign Het
Rab6a A G 7: 100,285,963 (GRCm39) E186G probably benign Het
Ralyl T A 3: 14,172,312 (GRCm39) D60E probably benign Het
Rtl1 G A 12: 109,556,673 (GRCm39) A1722V possibly damaging Het
Scarf1 T C 11: 75,406,006 (GRCm39) Y97H probably damaging Het
Sf3a2 T A 10: 80,640,560 (GRCm39) V457E unknown Het
Sh2d4b C G 14: 40,537,914 (GRCm39) E403Q probably damaging Het
Slc12a7 A G 13: 73,932,707 (GRCm39) E65G possibly damaging Het
Spred1 T C 2: 117,005,832 (GRCm39) F198S probably benign Het
St18 C A 1: 6,898,106 (GRCm39) T636K probably benign Het
Stag3 T A 5: 138,299,712 (GRCm39) D874E probably benign Het
Suco T C 1: 161,671,574 (GRCm39) T502A probably damaging Het
Swt1 T C 1: 151,278,787 (GRCm39) I457V probably benign Het
Syne2 G T 12: 75,997,823 (GRCm39) C2266F probably benign Het
Tcirg1 T C 19: 3,947,840 (GRCm39) N532D probably damaging Het
Tfdp1 T A 8: 13,420,580 (GRCm39) N136K probably benign Het
Tmem245 T C 4: 56,926,173 (GRCm39) probably benign Het
Tmem245 T C 4: 56,937,979 (GRCm39) I190V probably benign Het
Trp53bp1 C T 2: 121,046,177 (GRCm39) V1208M probably damaging Het
Tulp1 T A 17: 28,582,738 (GRCm39) K137* probably null Het
Zfp534 A T 4: 147,759,095 (GRCm39) C525S probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 44,120,938 (GRCm39) splice site probably benign
IGL00332:Spink5 APN 18 44,100,111 (GRCm39) missense probably benign 0.00
IGL00501:Spink5 APN 18 44,110,806 (GRCm39) missense probably damaging 0.98
IGL00772:Spink5 APN 18 44,139,487 (GRCm39) missense probably benign 0.02
IGL00920:Spink5 APN 18 44,136,276 (GRCm39) missense probably damaging 1.00
IGL00980:Spink5 APN 18 44,140,777 (GRCm39) missense probably damaging 1.00
IGL01016:Spink5 APN 18 44,140,711 (GRCm39) missense probably damaging 1.00
IGL01155:Spink5 APN 18 44,114,214 (GRCm39) missense probably benign 0.01
IGL01374:Spink5 APN 18 44,122,471 (GRCm39) missense possibly damaging 0.74
IGL01629:Spink5 APN 18 44,129,677 (GRCm39) splice site probably benign
IGL01907:Spink5 APN 18 44,129,743 (GRCm39) missense probably damaging 1.00
IGL01931:Spink5 APN 18 44,148,705 (GRCm39) missense probably benign 0.02
IGL02237:Spink5 APN 18 44,145,934 (GRCm39) missense probably benign 0.03
IGL02306:Spink5 APN 18 44,097,511 (GRCm39) missense probably damaging 0.98
IGL02402:Spink5 APN 18 44,100,171 (GRCm39) missense probably damaging 1.00
IGL02425:Spink5 APN 18 44,123,811 (GRCm39) critical splice donor site probably null
IGL02552:Spink5 APN 18 44,125,235 (GRCm39) missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44,148,661 (GRCm39) missense probably benign 0.01
IGL03066:Spink5 APN 18 44,149,457 (GRCm39) missense probably damaging 1.00
IGL03288:Spink5 APN 18 44,147,827 (GRCm39) missense possibly damaging 0.59
crusty2 UTSW 18 44,133,001 (GRCm39) splice site probably benign
R0079:Spink5 UTSW 18 44,110,831 (GRCm39) missense probably damaging 1.00
R0184:Spink5 UTSW 18 44,136,265 (GRCm39) missense probably benign 0.00
R0452:Spink5 UTSW 18 44,096,385 (GRCm39) missense possibly damaging 0.74
R0569:Spink5 UTSW 18 44,122,486 (GRCm39) missense probably damaging 1.00
R0639:Spink5 UTSW 18 44,146,042 (GRCm39) splice site probably null
R0648:Spink5 UTSW 18 44,132,864 (GRCm39) splice site probably benign
R0705:Spink5 UTSW 18 44,125,341 (GRCm39) missense probably benign 0.01
R1170:Spink5 UTSW 18 44,116,630 (GRCm39) missense probably benign 0.07
R1290:Spink5 UTSW 18 44,140,778 (GRCm39) missense probably damaging 0.99
R1345:Spink5 UTSW 18 44,123,749 (GRCm39) missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44,140,786 (GRCm39) missense probably benign 0.01
R1530:Spink5 UTSW 18 44,148,738 (GRCm39) missense probably damaging 0.96
R1570:Spink5 UTSW 18 44,100,174 (GRCm39) missense probably benign 0.00
R1820:Spink5 UTSW 18 44,122,486 (GRCm39) missense possibly damaging 0.94
R1843:Spink5 UTSW 18 44,132,958 (GRCm39) missense probably benign 0.03
R1968:Spink5 UTSW 18 44,123,775 (GRCm39) missense probably benign 0.06
R2050:Spink5 UTSW 18 44,140,825 (GRCm39) critical splice donor site probably null
R2252:Spink5 UTSW 18 44,153,891 (GRCm39) nonsense probably null
R2278:Spink5 UTSW 18 44,119,396 (GRCm39) missense probably benign 0.07
R2279:Spink5 UTSW 18 44,119,396 (GRCm39) missense probably benign 0.07
R2696:Spink5 UTSW 18 44,115,359 (GRCm39) missense probably damaging 1.00
R2992:Spink5 UTSW 18 44,129,696 (GRCm39) missense probably damaging 1.00
R3422:Spink5 UTSW 18 44,143,311 (GRCm39) missense probably benign 0.01
R3934:Spink5 UTSW 18 44,149,494 (GRCm39) missense probably damaging 1.00
R4179:Spink5 UTSW 18 44,120,934 (GRCm39) missense probably benign
R4854:Spink5 UTSW 18 44,153,908 (GRCm39) makesense probably null
R5011:Spink5 UTSW 18 44,139,479 (GRCm39) missense probably damaging 0.97
R5133:Spink5 UTSW 18 44,119,490 (GRCm39) missense probably damaging 1.00
R5163:Spink5 UTSW 18 44,132,924 (GRCm39) missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44,148,711 (GRCm39) missense probably damaging 0.97
R5187:Spink5 UTSW 18 44,122,518 (GRCm39) missense probably damaging 1.00
R5292:Spink5 UTSW 18 44,139,521 (GRCm39) missense probably benign
R5332:Spink5 UTSW 18 44,125,984 (GRCm39) missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44,151,778 (GRCm39) missense probably damaging 0.96
R6267:Spink5 UTSW 18 44,147,824 (GRCm39) missense probably damaging 0.99
R6296:Spink5 UTSW 18 44,147,824 (GRCm39) missense probably damaging 0.99
R6373:Spink5 UTSW 18 44,123,739 (GRCm39) missense probably damaging 1.00
R6982:Spink5 UTSW 18 44,143,109 (GRCm39) splice site probably null
R6982:Spink5 UTSW 18 44,110,792 (GRCm39) missense probably damaging 1.00
R7332:Spink5 UTSW 18 44,115,317 (GRCm39) missense probably damaging 0.96
R7396:Spink5 UTSW 18 44,110,722 (GRCm39) missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44,143,319 (GRCm39) missense probably benign 0.37
R7726:Spink5 UTSW 18 44,096,419 (GRCm39) missense probably damaging 1.00
R7828:Spink5 UTSW 18 44,143,296 (GRCm39) missense probably benign 0.15
R7836:Spink5 UTSW 18 44,132,888 (GRCm39) missense probably benign 0.00
R7880:Spink5 UTSW 18 44,119,393 (GRCm39) missense probably benign 0.40
R8031:Spink5 UTSW 18 44,143,303 (GRCm39) missense probably benign 0.07
R8198:Spink5 UTSW 18 44,125,947 (GRCm39) missense probably benign 0.17
R8361:Spink5 UTSW 18 44,122,529 (GRCm39) missense probably damaging 1.00
R8375:Spink5 UTSW 18 44,123,786 (GRCm39) missense probably benign 0.01
R8684:Spink5 UTSW 18 44,143,305 (GRCm39) missense probably benign 0.02
R8749:Spink5 UTSW 18 44,122,425 (GRCm39) nonsense probably null
R8918:Spink5 UTSW 18 44,100,087 (GRCm39) missense probably damaging 0.98
R9064:Spink5 UTSW 18 44,100,193 (GRCm39) missense probably damaging 1.00
R9161:Spink5 UTSW 18 44,147,986 (GRCm39) missense probably damaging 1.00
R9221:Spink5 UTSW 18 44,119,367 (GRCm39) missense probably damaging 1.00
R9545:Spink5 UTSW 18 44,136,262 (GRCm39) missense possibly damaging 0.88
R9784:Spink5 UTSW 18 44,119,490 (GRCm39) missense probably damaging 1.00
Z1177:Spink5 UTSW 18 44,129,764 (GRCm39) missense probably damaging 1.00
Z1177:Spink5 UTSW 18 44,129,702 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCGAGTTTGAGAAAACCACC -3'
(R):5'- TTTGGAATGAGCACCCTGATAAG -3'

Sequencing Primer
(F):5'- CATCAACAAAGGAAAAGCTTATGC -3'
(R):5'- TGGAATGAGCACCCTGATAAGAATAC -3'
Posted On 2022-03-25