Incidental Mutation 'R0755:Snx33'
ID70438
Institutional Source Beutler Lab
Gene Symbol Snx33
Ensembl Gene ENSMUSG00000032733
Gene Namesorting nexin 33
SynonymsSh3px3, E130307J07Rik
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0755 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56917193-56928371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56925457 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 443 (I443V)
Ref Sequence ENSEMBL: ENSMUSP00000060225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050916
AA Change: I443V

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: I443V

DomainStartEndE-ValueType
SH3 3 60 3.2e-15 SMART
low complexity region 111 122 N/A INTRINSIC
PX 227 336 6.69e-18 SMART
Pfam:BAR_3_WASP_bdg 337 572 1.1e-113 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baiap2l1 T C 5: 144,284,557 K176E probably damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Chrm4 T C 2: 91,928,402 V385A probably benign Het
Cntrl G A 2: 35,145,139 S373N probably damaging Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Cyb5r4 G T 9: 87,029,572 A100S probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc4a2 G A 5: 24,435,577 A652T probably benign Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn1r33 A T 6: 66,611,908 S221T probably damaging Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Snx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Snx33 APN 9 56926578 missense probably benign
IGL02646:Snx33 APN 9 56926759 missense probably damaging 1.00
IGL03028:Snx33 APN 9 56926451 missense probably benign
R0206:Snx33 UTSW 9 56926224 missense probably damaging 1.00
R1218:Snx33 UTSW 9 56925985 missense probably damaging 1.00
R1523:Snx33 UTSW 9 56926182 missense possibly damaging 0.47
R1627:Snx33 UTSW 9 56925957 missense probably damaging 1.00
R1758:Snx33 UTSW 9 56926698 missense probably benign 0.29
R1856:Snx33 UTSW 9 56926011 missense possibly damaging 0.85
R1885:Snx33 UTSW 9 56925837 missense probably benign 0.42
R2113:Snx33 UTSW 9 56926440 missense probably benign 0.28
R2422:Snx33 UTSW 9 56918538 missense probably benign 0.03
R3789:Snx33 UTSW 9 56918560 missense probably benign 0.00
R3870:Snx33 UTSW 9 56926740 missense probably benign 0.05
R3871:Snx33 UTSW 9 56926740 missense probably benign 0.05
R4734:Snx33 UTSW 9 56925901 missense possibly damaging 0.84
R4884:Snx33 UTSW 9 56926180 missense probably damaging 0.99
R5069:Snx33 UTSW 9 56926191 missense probably damaging 0.97
R5555:Snx33 UTSW 9 56925397 missense probably benign
R6153:Snx33 UTSW 9 56926699 missense possibly damaging 0.74
R7178:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7179:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7315:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7414:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7593:Snx33 UTSW 9 56926774 missense possibly damaging 0.52
R7607:Snx33 UTSW 9 56926713 missense probably benign
R7632:Snx33 UTSW 9 56926418 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTATCTCTCTGCCTACAACAGCAC -3'
(R):5'- AGCGTCCTACAGCTTAGCAACG -3'

Sequencing Primer
(F):5'- AGCTGTTCATAGTCCAGGC -3'
(R):5'- AGCTTAGCAACGTGGCG -3'
Posted On2013-09-30