Incidental Mutation 'R9293:1110002E22Rik'
ID 704380
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R9293 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138066078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 343 (S343P)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect possibly damaging
Transcript: ENSMUST00000163080
AA Change: S343P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: S343P

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,498,303 A86V probably benign Het
4930563M21Rik T A 9: 56,009,284 E36D unknown Het
Abcc8 T G 7: 46,106,668 K1450T probably benign Het
Aox2 A T 1: 58,322,794 N720Y possibly damaging Het
AW549877 T C 15: 3,991,854 D73G probably damaging Het
BC034090 T C 1: 155,225,772 T249A probably benign Het
Brf2 A T 8: 27,123,993 S388R probably damaging Het
Ccdc180 A T 4: 45,944,461 Q1437L probably damaging Het
Cdc42ep1 A C 15: 78,849,825 D375A probably benign Het
Cep85l T C 10: 53,298,186 Y487C probably damaging Het
Chd3 C T 11: 69,353,201 R1346H possibly damaging Het
Cltc T A 11: 86,712,620 R793S possibly damaging Het
Crat A G 2: 30,408,202 F162L probably benign Het
Cyp3a44 C A 5: 145,774,377 V495L probably benign Het
Dchs2 C T 3: 83,282,054 T1575I possibly damaging Het
Ddx60 A G 8: 62,009,960 T1292A possibly damaging Het
Dnah12 C T 14: 26,773,059 A109V probably benign Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fry T C 5: 150,495,832 S546P Het
Hfe T C 13: 23,706,809 K204E probably benign Het
Hibch T A 1: 52,913,827 Y329N probably damaging Het
Irf9 T G 14: 55,608,790 I426S probably damaging Het
Kif26a C A 12: 112,146,401 P13T probably damaging Het
Lhx5 A C 5: 120,432,386 K36Q probably benign Het
Mdn1 T C 4: 32,707,579 S1623P probably damaging Het
Mre11a T C 9: 14,799,588 F193L probably damaging Het
Mybl2 G A 2: 163,068,215 G187E probably damaging Het
Myh1 A T 11: 67,209,103 Q613L probably benign Het
Myo5a T A 9: 75,180,030 M1056K probably benign Het
Olfr1 T C 11: 73,395,129 K298E probably damaging Het
Olfr1197 G A 2: 88,729,455 T48I probably benign Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr918 T C 9: 38,673,118 I109V probably damaging Het
Pcdhga12 G A 18: 37,767,887 V591M probably damaging Het
Phyhipl A G 10: 70,565,286 S161P probably damaging Het
Pmfbp1 A G 8: 109,536,573 T775A probably benign Het
Pou3f3 T C 1: 42,697,522 V126A unknown Het
Reg4 A C 3: 98,236,315 K142Q possibly damaging Het
Sec22c G T 9: 121,688,248 A199E probably damaging Het
Sema3d C T 5: 12,553,214 P395S probably damaging Het
Sh2b2 C T 5: 136,232,039 E108K possibly damaging Het
Slfn3 A G 11: 83,214,790 K538E possibly damaging Het
Spatc1l A T 10: 76,569,366 D194V probably damaging Het
Stoml3 T C 3: 53,500,764 V77A possibly damaging Het
Taco1 A G 11: 106,073,104 I230V probably benign Het
Tfcp2 T C 15: 100,514,053 T346A probably benign Het
Tmem8b C T 4: 43,686,188 T273M probably damaging Het
Trav6-1 A G 14: 52,638,842 N73S probably benign Het
Trav6d-5 A G 14: 52,795,603 D103G probably damaging Het
Ttll5 T A 12: 85,891,032 L379Q probably damaging Het
Ubr3 A C 2: 69,897,425 D44A probably benign Het
Upp2 G T 2: 58,567,431 R5L unknown Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r17 C T 5: 109,452,846 T670I probably damaging Het
Zfp433 A T 10: 81,720,288 H208L probably damaging Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAAGACAATGGCCTTTC -3'
(R):5'- GGTCTCATCACTGCCACCAAAG -3'

Sequencing Primer
(F):5'- TGGACGATCCCACCAAGTTACTG -3'
(R):5'- GCCACCAAAGGAAGCGTAGTC -3'
Posted On 2022-03-25