Incidental Mutation 'R9293:Myo5a'
ID 704400
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms 9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R9293 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 75071015-75223688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75180030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1056 (M1056K)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably benign
Transcript: ENSMUST00000123128
AA Change: M1056K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: M1056K

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably benign
Transcript: ENSMUST00000136731
AA Change: M1056K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: M1056K

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155282
AA Change: M1056K

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: M1056K

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,066,078 S343P possibly damaging Het
1700007G11Rik C T 5: 98,498,303 A86V probably benign Het
4930563M21Rik T A 9: 56,009,284 E36D unknown Het
Abcc8 T G 7: 46,106,668 K1450T probably benign Het
Aox2 A T 1: 58,322,794 N720Y possibly damaging Het
AW549877 T C 15: 3,991,854 D73G probably damaging Het
BC034090 T C 1: 155,225,772 T249A probably benign Het
Brf2 A T 8: 27,123,993 S388R probably damaging Het
Ccdc180 A T 4: 45,944,461 Q1437L probably damaging Het
Cdc42ep1 A C 15: 78,849,825 D375A probably benign Het
Cep85l T C 10: 53,298,186 Y487C probably damaging Het
Chd3 C T 11: 69,353,201 R1346H possibly damaging Het
Cltc T A 11: 86,712,620 R793S possibly damaging Het
Crat A G 2: 30,408,202 F162L probably benign Het
Cyp3a44 C A 5: 145,774,377 V495L probably benign Het
Dchs2 C T 3: 83,282,054 T1575I possibly damaging Het
Ddx60 A G 8: 62,009,960 T1292A possibly damaging Het
Dnah12 C T 14: 26,773,059 A109V probably benign Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fry T C 5: 150,495,832 S546P Het
Hfe T C 13: 23,706,809 K204E probably benign Het
Hibch T A 1: 52,913,827 Y329N probably damaging Het
Irf9 T G 14: 55,608,790 I426S probably damaging Het
Kif26a C A 12: 112,146,401 P13T probably damaging Het
Lhx5 A C 5: 120,432,386 K36Q probably benign Het
Mdn1 T C 4: 32,707,579 S1623P probably damaging Het
Mre11a T C 9: 14,799,588 F193L probably damaging Het
Mybl2 G A 2: 163,068,215 G187E probably damaging Het
Myh1 A T 11: 67,209,103 Q613L probably benign Het
Olfr1 T C 11: 73,395,129 K298E probably damaging Het
Olfr1197 G A 2: 88,729,455 T48I probably benign Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr918 T C 9: 38,673,118 I109V probably damaging Het
Pcdhga12 G A 18: 37,767,887 V591M probably damaging Het
Phyhipl A G 10: 70,565,286 S161P probably damaging Het
Pmfbp1 A G 8: 109,536,573 T775A probably benign Het
Pou3f3 T C 1: 42,697,522 V126A unknown Het
Reg4 A C 3: 98,236,315 K142Q possibly damaging Het
Sec22c G T 9: 121,688,248 A199E probably damaging Het
Sema3d C T 5: 12,553,214 P395S probably damaging Het
Sh2b2 C T 5: 136,232,039 E108K possibly damaging Het
Slfn3 A G 11: 83,214,790 K538E possibly damaging Het
Spatc1l A T 10: 76,569,366 D194V probably damaging Het
Stoml3 T C 3: 53,500,764 V77A possibly damaging Het
Taco1 A G 11: 106,073,104 I230V probably benign Het
Tfcp2 T C 15: 100,514,053 T346A probably benign Het
Tmem8b C T 4: 43,686,188 T273M probably damaging Het
Trav6-1 A G 14: 52,638,842 N73S probably benign Het
Trav6d-5 A G 14: 52,795,603 D103G probably damaging Het
Ttll5 T A 12: 85,891,032 L379Q probably damaging Het
Ube3c T A 5: 29,598,848 probably benign Het
Ubr3 A C 2: 69,897,425 D44A probably benign Het
Upp2 G T 2: 58,567,431 R5L unknown Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r17 C T 5: 109,452,846 T670I probably damaging Het
Zfp433 A T 10: 81,720,288 H208L probably damaging Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211126 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 splice site probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 splice site probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
R7620:Myo5a UTSW 9 75164136 missense probably benign 0.41
R7719:Myo5a UTSW 9 75144084 missense probably benign 0.01
R7810:Myo5a UTSW 9 75160465 missense probably benign 0.09
R7810:Myo5a UTSW 9 75169010 missense probably benign
R7866:Myo5a UTSW 9 75203752 missense probably damaging 1.00
R7939:Myo5a UTSW 9 75189900 missense
R8050:Myo5a UTSW 9 75181946 missense probably damaging 0.99
R8061:Myo5a UTSW 9 75122957 nonsense probably null
R8326:Myo5a UTSW 9 75217989 missense probably damaging 0.98
R8529:Myo5a UTSW 9 75212872 missense probably benign 0.02
R8824:Myo5a UTSW 9 75167046 missense probably damaging 1.00
R8858:Myo5a UTSW 9 75184683 missense probably damaging 0.99
R9040:Myo5a UTSW 9 75174059 missense probably benign 0.07
R9092:Myo5a UTSW 9 75147132 critical splice donor site probably null
R9249:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R9366:Myo5a UTSW 9 75217518 missense probably damaging 0.98
R9410:Myo5a UTSW 9 75116214 missense probably damaging 0.98
R9644:Myo5a UTSW 9 75136349 missense probably damaging 1.00
R9649:Myo5a UTSW 9 75192444 missense
R9748:Myo5a UTSW 9 75184683 missense probably damaging 0.99
R9766:Myo5a UTSW 9 75171632 missense probably damaging 0.99
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75186036 missense
Predicted Primers PCR Primer
(F):5'- TCTCTGGCACAAGGAACAGC -3'
(R):5'- ACGTATCACAGATCATGCCTTC -3'

Sequencing Primer
(F):5'- TGGCCAGGCATGCTGTTC -3'
(R):5'- GCCTCTCATCATTCAGGT -3'
Posted On 2022-03-25