Incidental Mutation 'R0755:Cyb5r4'
ID70442
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Namecytochrome b5 reductase 4
Synonymsb5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0755 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location87022014-87077774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87029572 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 100 (A100S)
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
Predicted Effect probably damaging
Transcript: ENSMUST00000168529
AA Change: A100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872
AA Change: A100S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174724
SMART Domains Protein: ENSMUSP00000133556
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.2e-16 PFAM
Pfam:FAD_binding_6 284 391 1.7e-22 PFAM
Pfam:NAD_binding_1 402 509 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baiap2l1 T C 5: 144,284,557 K176E probably damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Chrm4 T C 2: 91,928,402 V385A probably benign Het
Cntrl G A 2: 35,145,139 S373N probably damaging Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc4a2 G A 5: 24,435,577 A652T probably benign Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Snx33 T C 9: 56,925,457 I443V possibly damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn1r33 A T 6: 66,611,908 S221T probably damaging Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGACATATTTAGTGGGTGGTCTGAGTGA -3'
(R):5'- TGCCGACATTTCAGAGTTCAAGCC -3'

Sequencing Primer
(F):5'- tcactggcatttaggaaggac -3'
(R):5'- TTTCAGAGTTCAAGCCCACCC -3'
Posted On2013-09-30