Incidental Mutation 'R9294:Axdnd1'
ID 704428
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms 9430070O13Rik, LOC381304
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 156157985-156248743 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 156247917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 28 (K28*)
Ref Sequence ENSEMBL: ENSMUSP00000136339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000179744] [ENSMUST00000179985] [ENSMUST00000189661] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177824
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178036
AA Change: K28*
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: K28*

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179744
AA Change: K28*
Predicted Effect probably null
Transcript: ENSMUST00000179985
AA Change: K28*
Predicted Effect probably benign
Transcript: ENSMUST00000189661
SMART Domains Protein: ENSMUSP00000140721
Gene: ENSMUSG00000026600

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 1.2e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213088
AA Change: K28*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik A G 8: 84,730,008 (GRCm39) Y165C probably damaging Het
Abcb11 T A 2: 69,095,840 (GRCm39) K833N possibly damaging Het
Abcb1a T A 5: 8,736,171 (GRCm39) M188K probably benign Het
Akap1 A T 11: 88,727,966 (GRCm39) V672D probably damaging Het
Anapc4 A G 5: 53,021,867 (GRCm39) T650A possibly damaging Het
Ash1l C A 3: 88,890,297 (GRCm39) S725R possibly damaging Het
C8b C A 4: 104,644,192 (GRCm39) H286Q probably benign Het
Cacna2d1 A G 5: 16,217,396 (GRCm39) K34E probably damaging Het
Ccdc14 T A 16: 34,517,728 (GRCm39) H154Q probably damaging Het
Ccdc184 A G 15: 98,066,393 (GRCm39) D66G probably damaging Het
Ccdc62 A G 5: 124,092,772 (GRCm39) I586V possibly damaging Het
Cfap20dc A G 14: 8,578,361 (GRCm38) I127T possibly damaging Het
Chadl A T 15: 81,578,691 (GRCm39) C313S probably damaging Het
Clec14a C A 12: 58,315,536 (GRCm39) A29S probably damaging Het
Col26a1 C T 5: 136,786,608 (GRCm39) G161D probably benign Het
Cplane1 T C 15: 8,232,811 (GRCm39) V1110A probably benign Het
Ctbp2 A G 7: 132,615,961 (GRCm39) S325P probably damaging Het
Dcaf13 A G 15: 38,993,687 (GRCm39) D260G possibly damaging Het
Dele1 T G 18: 38,394,129 (GRCm39) L442R probably damaging Het
Dhx37 G A 5: 125,499,736 (GRCm39) P575L probably benign Het
Dnajc6 T C 4: 101,408,054 (GRCm39) probably null Het
Eapp T C 12: 54,737,061 (GRCm39) T145A unknown Het
Efcab3 A G 11: 104,722,126 (GRCm39) I1913V probably benign Het
Efcab5 A G 11: 77,012,064 (GRCm39) M730T probably benign Het
Eif4g3 T A 4: 137,917,968 (GRCm39) D1305E probably damaging Het
Endou A T 15: 97,609,946 (GRCm39) V450E probably benign Het
F10 A T 8: 13,098,177 (GRCm39) K127* probably null Het
Fbxw21 A G 9: 108,972,830 (GRCm39) F368S probably damaging Het
Fezf1 A T 6: 23,245,797 (GRCm39) L456Q possibly damaging Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Fyco1 A C 9: 123,623,878 (GRCm39) C1384G probably damaging Het
Galnt6 G T 15: 100,602,032 (GRCm39) S258R possibly damaging Het
Gemin5 A G 11: 58,028,574 (GRCm39) V882A probably benign Het
Gm10750 A G 2: 148,858,107 (GRCm39) L48P unknown Het
Gm16503 T A 4: 147,625,571 (GRCm39) F22I unknown Het
Hdac10 A G 15: 89,010,480 (GRCm39) C281R probably damaging Het
Hikeshi T C 7: 89,584,968 (GRCm39) S79G probably damaging Het
Ifitm2 AG A 7: 140,535,814 (GRCm39) probably null Het
Itpr3 A G 17: 27,330,191 (GRCm39) E1603G probably damaging Het
Lrrc37a A T 11: 103,395,359 (GRCm39) V22E probably benign Het
Man1a C T 10: 53,809,587 (GRCm39) probably null Het
Mdga1 A G 17: 30,058,871 (GRCm39) L5P probably damaging Het
Mup6 A G 4: 60,004,838 (GRCm39) I76M probably benign Het
Nbea A T 3: 55,998,513 (GRCm39) M98K probably benign Het
Nckap1l A G 15: 103,381,966 (GRCm39) E454G probably damaging Het
Notch3 A T 17: 32,362,665 (GRCm39) L1320Q probably benign Het
Nrn1 A T 13: 36,910,648 (GRCm39) L128H probably damaging Het
Numa1 T C 7: 101,644,623 (GRCm39) S200P possibly damaging Het
Numa1 A G 7: 101,662,003 (GRCm39) D1898G probably damaging Het
Or10ag58 G A 2: 87,265,010 (GRCm39) A60T probably benign Het
Or1af1 T C 2: 37,110,122 (GRCm39) I207T possibly damaging Het
Or2ag18 A T 7: 106,405,605 (GRCm39) S21R possibly damaging Het
Or5i1 A C 2: 87,612,867 (GRCm39) probably null Het
P2ry6 A T 7: 100,588,133 (GRCm39) Y75* probably null Het
Pbrm1 T A 14: 30,806,760 (GRCm39) C1062* probably null Het
Pcdh15 A G 10: 74,479,560 (GRCm39) E557G unknown Het
Pcdh7 T C 5: 57,878,677 (GRCm39) L744P probably benign Het
Plekhg3 A T 12: 76,609,052 (GRCm39) I142L possibly damaging Het
Plk4 C T 3: 40,766,326 (GRCm39) H695Y probably damaging Het
Pms1 T C 1: 53,247,216 (GRCm39) H243R probably benign Het
Prdm14 T C 1: 13,192,707 (GRCm39) D344G possibly damaging Het
R3hdml A G 2: 163,344,252 (GRCm39) I214V probably benign Het
Rab11fip5 T C 6: 85,325,692 (GRCm39) N238S probably benign Het
Resf1 T A 6: 149,227,930 (GRCm39) N325K probably benign Het
Sacs T A 14: 61,477,768 (GRCm39) Y732N possibly damaging Het
Scfd1 T A 12: 51,440,649 (GRCm39) M187K possibly damaging Het
Serpina1d A G 12: 103,734,257 (GRCm39) C16R probably damaging Het
Slc2a12 T C 10: 22,540,994 (GRCm39) I283T possibly damaging Het
Smarca5 A G 8: 81,446,432 (GRCm39) Y423H probably damaging Het
Srrm3 C A 5: 135,897,115 (GRCm39) A366E unknown Het
St7 A T 6: 17,844,913 (GRCm39) K134* probably null Het
St8sia5 T G 18: 77,342,525 (GRCm39) C412G probably damaging Het
Tanc2 A T 11: 105,777,284 (GRCm39) I821F probably damaging Het
Tbrg4 A G 11: 6,574,204 (GRCm39) M6T probably benign Het
Tcf20 A T 15: 82,736,897 (GRCm39) I1518N probably benign Het
Tctn3 A G 19: 40,595,720 (GRCm39) V355A probably benign Het
Tenm2 A T 11: 35,915,327 (GRCm39) F2070Y probably damaging Het
Tex2 A G 11: 106,459,361 (GRCm39) V23A probably damaging Het
Thrsp C G 7: 97,066,281 (GRCm39) E144Q probably damaging Het
Tmt1a A G 15: 100,211,014 (GRCm39) E213G probably damaging Het
Top2a A C 11: 98,891,904 (GRCm39) S1114A probably benign Het
Tpm1 A G 9: 66,936,998 (GRCm39) Y267H probably benign Het
Txndc2 G T 17: 65,946,019 (GRCm39) P53T unknown Het
Ugt2b36 A T 5: 87,228,876 (GRCm39) I389N probably damaging Het
Virma C T 4: 11,513,507 (GRCm39) R454* probably null Het
Vwa3b T A 1: 37,074,882 (GRCm39) H16Q probably damaging Het
Zbp1 A G 2: 173,052,436 (GRCm39) M240T possibly damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156,204,233 (GRCm39) missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156,223,012 (GRCm39) missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156,205,959 (GRCm39) missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156,208,456 (GRCm39) missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156,193,259 (GRCm39) missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156,205,950 (GRCm39) critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156,176,530 (GRCm39) missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156,174,271 (GRCm39) missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156,204,114 (GRCm39) missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156,208,344 (GRCm39) splice site probably null
R2126:Axdnd1 UTSW 1 156,160,784 (GRCm39) missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156,219,573 (GRCm39) missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156,245,879 (GRCm39) missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156,193,221 (GRCm39) missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156,220,319 (GRCm39) missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156,208,428 (GRCm39) missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156,246,840 (GRCm39) missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156,159,209 (GRCm39) missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156,204,216 (GRCm39) missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156,223,129 (GRCm39) splice site probably null
R4969:Axdnd1 UTSW 1 156,223,075 (GRCm39) missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156,247,980 (GRCm39) missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156,162,920 (GRCm39) missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156,226,104 (GRCm39) missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156,178,982 (GRCm39) missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156,169,459 (GRCm39) missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156,176,528 (GRCm39) missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156,193,182 (GRCm39) splice site probably null
R6208:Axdnd1 UTSW 1 156,220,426 (GRCm39) intron probably benign
R6369:Axdnd1 UTSW 1 156,220,315 (GRCm39) missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156,208,383 (GRCm39) missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156,158,532 (GRCm39) splice site probably null
R7115:Axdnd1 UTSW 1 156,208,446 (GRCm39) missense
R7203:Axdnd1 UTSW 1 156,209,959 (GRCm39) missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156,210,047 (GRCm39) missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156,245,802 (GRCm39) critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156,204,086 (GRCm39) missense
R7686:Axdnd1 UTSW 1 156,223,034 (GRCm39) nonsense probably null
R7793:Axdnd1 UTSW 1 156,166,313 (GRCm39) critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156,220,371 (GRCm39) nonsense probably null
R7882:Axdnd1 UTSW 1 156,225,023 (GRCm39) missense
R8256:Axdnd1 UTSW 1 156,158,236 (GRCm39) missense unknown
R8348:Axdnd1 UTSW 1 156,245,854 (GRCm39) missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156,219,516 (GRCm39) missense
R9207:Axdnd1 UTSW 1 156,215,616 (GRCm39) missense
R9741:Axdnd1 UTSW 1 156,169,385 (GRCm39) missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156,215,649 (GRCm39) missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156,204,105 (GRCm39) missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156,176,633 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCTTGAAGTCAGAGAAGAAG -3'
(R):5'- GGAAACCACGCCAGATGAATTC -3'

Sequencing Primer
(F):5'- CCTTGAAGTCAGAGAAGAAGCAACC -3'
(R):5'- GCCTACAGAATTATGGACAGCTTG -3'
Posted On 2022-03-25