Incidental Mutation 'R9294:Nbea'
ID 704437
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_030595
Essential gene? Essential (E-score: 1.000) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55625195-56183701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56091092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 98 (M98K)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029374
AA Change: M98K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: M98K

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
scotland UTSW 3 55626908 missense probably damaging 1.00
Wales UTSW 3 56091119 missense probably damaging 1.00
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1872:Nbea UTSW 3 55642889 missense probably benign 0.12
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2097:Nbea UTSW 3 55723217 missense probably damaging 0.96
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4758:Nbea UTSW 3 56005403 missense probably benign
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6488:Nbea UTSW 3 55717843 missense probably damaging 0.99
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7935:Nbea UTSW 3 56058665 missense probably damaging 1.00
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
R8290:Nbea UTSW 3 56058635 nonsense probably null
R8314:Nbea UTSW 3 56009251 missense probably damaging 0.99
R8321:Nbea UTSW 3 56183097 missense possibly damaging 0.86
R8376:Nbea UTSW 3 55643655 missense possibly damaging 0.79
R8410:Nbea UTSW 3 56037263 missense probably damaging 1.00
R8556:Nbea UTSW 3 55647386 missense probably benign 0.25
R8753:Nbea UTSW 3 55626908 missense probably damaging 1.00
R8844:Nbea UTSW 3 56090994 missense probably damaging 0.97
R8884:Nbea UTSW 3 55805299 missense probably benign 0.00
R8886:Nbea UTSW 3 56058727 missense probably damaging 1.00
R8890:Nbea UTSW 3 56019363 splice site probably benign
R9004:Nbea UTSW 3 56002938 missense probably benign 0.01
R9022:Nbea UTSW 3 55643689 missense possibly damaging 0.79
R9080:Nbea UTSW 3 56005095 nonsense probably null
R9087:Nbea UTSW 3 55642736 critical splice donor site probably null
R9104:Nbea UTSW 3 55955388 missense probably benign
R9165:Nbea UTSW 3 56004868 missense probably benign 0.15
R9219:Nbea UTSW 3 56090972 frame shift probably null
R9221:Nbea UTSW 3 56090972 frame shift probably null
R9222:Nbea UTSW 3 56090972 frame shift probably null
R9260:Nbea UTSW 3 55983812 missense possibly damaging 0.50
R9263:Nbea UTSW 3 56090972 frame shift probably null
R9265:Nbea UTSW 3 56090972 frame shift probably null
R9360:Nbea UTSW 3 56035898 missense possibly damaging 0.96
R9387:Nbea UTSW 3 55991039 missense probably benign 0.12
R9428:Nbea UTSW 3 56090972 frame shift probably null
R9435:Nbea UTSW 3 56035888 missense possibly damaging 0.63
R9507:Nbea UTSW 3 55665590 missense probably damaging 1.00
R9514:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9516:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9674:Nbea UTSW 3 56058762 missense probably damaging 1.00
R9688:Nbea UTSW 3 55649744 missense probably benign 0.42
R9709:Nbea UTSW 3 55786458 nonsense probably null
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACTCATTTTCAGCAACAC -3'
(R):5'- CCCACAATTATTTGATGGTGTGTG -3'

Sequencing Primer
(F):5'- TTCTGCTTGGCATGTCAC -3'
(R):5'- CCTTCCACCTTTGTAAAAATTAAACC -3'
Posted On 2022-03-25