Incidental Mutation 'R9294:Anapc4'
ID 704447
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Name anaphase promoting complex subunit 4
Synonyms D5Ertd249e, 2610306D21Rik, APC4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 52991477-53024076 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53021867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 650 (T650A)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
AlphaFold Q91W96
Predicted Effect possibly damaging
Transcript: ENSMUST00000031072
AA Change: T650A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: T650A

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik A G 8: 84,730,008 (GRCm39) Y165C probably damaging Het
Abcb11 T A 2: 69,095,840 (GRCm39) K833N possibly damaging Het
Abcb1a T A 5: 8,736,171 (GRCm39) M188K probably benign Het
Akap1 A T 11: 88,727,966 (GRCm39) V672D probably damaging Het
Ash1l C A 3: 88,890,297 (GRCm39) S725R possibly damaging Het
Axdnd1 T A 1: 156,247,917 (GRCm39) K28* probably null Het
C8b C A 4: 104,644,192 (GRCm39) H286Q probably benign Het
Cacna2d1 A G 5: 16,217,396 (GRCm39) K34E probably damaging Het
Ccdc14 T A 16: 34,517,728 (GRCm39) H154Q probably damaging Het
Ccdc184 A G 15: 98,066,393 (GRCm39) D66G probably damaging Het
Ccdc62 A G 5: 124,092,772 (GRCm39) I586V possibly damaging Het
Cfap20dc A G 14: 8,578,361 (GRCm38) I127T possibly damaging Het
Chadl A T 15: 81,578,691 (GRCm39) C313S probably damaging Het
Clec14a C A 12: 58,315,536 (GRCm39) A29S probably damaging Het
Col26a1 C T 5: 136,786,608 (GRCm39) G161D probably benign Het
Cplane1 T C 15: 8,232,811 (GRCm39) V1110A probably benign Het
Ctbp2 A G 7: 132,615,961 (GRCm39) S325P probably damaging Het
Dcaf13 A G 15: 38,993,687 (GRCm39) D260G possibly damaging Het
Dele1 T G 18: 38,394,129 (GRCm39) L442R probably damaging Het
Dhx37 G A 5: 125,499,736 (GRCm39) P575L probably benign Het
Dnajc6 T C 4: 101,408,054 (GRCm39) probably null Het
Eapp T C 12: 54,737,061 (GRCm39) T145A unknown Het
Efcab3 A G 11: 104,722,126 (GRCm39) I1913V probably benign Het
Efcab5 A G 11: 77,012,064 (GRCm39) M730T probably benign Het
Eif4g3 T A 4: 137,917,968 (GRCm39) D1305E probably damaging Het
Endou A T 15: 97,609,946 (GRCm39) V450E probably benign Het
F10 A T 8: 13,098,177 (GRCm39) K127* probably null Het
Fbxw21 A G 9: 108,972,830 (GRCm39) F368S probably damaging Het
Fezf1 A T 6: 23,245,797 (GRCm39) L456Q possibly damaging Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Fyco1 A C 9: 123,623,878 (GRCm39) C1384G probably damaging Het
Galnt6 G T 15: 100,602,032 (GRCm39) S258R possibly damaging Het
Gemin5 A G 11: 58,028,574 (GRCm39) V882A probably benign Het
Gm10750 A G 2: 148,858,107 (GRCm39) L48P unknown Het
Gm16503 T A 4: 147,625,571 (GRCm39) F22I unknown Het
Hdac10 A G 15: 89,010,480 (GRCm39) C281R probably damaging Het
Hikeshi T C 7: 89,584,968 (GRCm39) S79G probably damaging Het
Ifitm2 AG A 7: 140,535,814 (GRCm39) probably null Het
Itpr3 A G 17: 27,330,191 (GRCm39) E1603G probably damaging Het
Lrrc37a A T 11: 103,395,359 (GRCm39) V22E probably benign Het
Man1a C T 10: 53,809,587 (GRCm39) probably null Het
Mdga1 A G 17: 30,058,871 (GRCm39) L5P probably damaging Het
Mup6 A G 4: 60,004,838 (GRCm39) I76M probably benign Het
Nbea A T 3: 55,998,513 (GRCm39) M98K probably benign Het
Nckap1l A G 15: 103,381,966 (GRCm39) E454G probably damaging Het
Notch3 A T 17: 32,362,665 (GRCm39) L1320Q probably benign Het
Nrn1 A T 13: 36,910,648 (GRCm39) L128H probably damaging Het
Numa1 T C 7: 101,644,623 (GRCm39) S200P possibly damaging Het
Numa1 A G 7: 101,662,003 (GRCm39) D1898G probably damaging Het
Or10ag58 G A 2: 87,265,010 (GRCm39) A60T probably benign Het
Or1af1 T C 2: 37,110,122 (GRCm39) I207T possibly damaging Het
Or2ag18 A T 7: 106,405,605 (GRCm39) S21R possibly damaging Het
Or5i1 A C 2: 87,612,867 (GRCm39) probably null Het
P2ry6 A T 7: 100,588,133 (GRCm39) Y75* probably null Het
Pbrm1 T A 14: 30,806,760 (GRCm39) C1062* probably null Het
Pcdh15 A G 10: 74,479,560 (GRCm39) E557G unknown Het
Pcdh7 T C 5: 57,878,677 (GRCm39) L744P probably benign Het
Plekhg3 A T 12: 76,609,052 (GRCm39) I142L possibly damaging Het
Plk4 C T 3: 40,766,326 (GRCm39) H695Y probably damaging Het
Pms1 T C 1: 53,247,216 (GRCm39) H243R probably benign Het
Prdm14 T C 1: 13,192,707 (GRCm39) D344G possibly damaging Het
R3hdml A G 2: 163,344,252 (GRCm39) I214V probably benign Het
Rab11fip5 T C 6: 85,325,692 (GRCm39) N238S probably benign Het
Resf1 T A 6: 149,227,930 (GRCm39) N325K probably benign Het
Sacs T A 14: 61,477,768 (GRCm39) Y732N possibly damaging Het
Scfd1 T A 12: 51,440,649 (GRCm39) M187K possibly damaging Het
Serpina1d A G 12: 103,734,257 (GRCm39) C16R probably damaging Het
Slc2a12 T C 10: 22,540,994 (GRCm39) I283T possibly damaging Het
Smarca5 A G 8: 81,446,432 (GRCm39) Y423H probably damaging Het
Srrm3 C A 5: 135,897,115 (GRCm39) A366E unknown Het
St7 A T 6: 17,844,913 (GRCm39) K134* probably null Het
St8sia5 T G 18: 77,342,525 (GRCm39) C412G probably damaging Het
Tanc2 A T 11: 105,777,284 (GRCm39) I821F probably damaging Het
Tbrg4 A G 11: 6,574,204 (GRCm39) M6T probably benign Het
Tcf20 A T 15: 82,736,897 (GRCm39) I1518N probably benign Het
Tctn3 A G 19: 40,595,720 (GRCm39) V355A probably benign Het
Tenm2 A T 11: 35,915,327 (GRCm39) F2070Y probably damaging Het
Tex2 A G 11: 106,459,361 (GRCm39) V23A probably damaging Het
Thrsp C G 7: 97,066,281 (GRCm39) E144Q probably damaging Het
Tmt1a A G 15: 100,211,014 (GRCm39) E213G probably damaging Het
Top2a A C 11: 98,891,904 (GRCm39) S1114A probably benign Het
Tpm1 A G 9: 66,936,998 (GRCm39) Y267H probably benign Het
Txndc2 G T 17: 65,946,019 (GRCm39) P53T unknown Het
Ugt2b36 A T 5: 87,228,876 (GRCm39) I389N probably damaging Het
Virma C T 4: 11,513,507 (GRCm39) R454* probably null Het
Vwa3b T A 1: 37,074,882 (GRCm39) H16Q probably damaging Het
Zbp1 A G 2: 173,052,436 (GRCm39) M240T possibly damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 53,014,553 (GRCm39) missense probably damaging 0.98
IGL01066:Anapc4 APN 5 53,014,551 (GRCm39) missense probably benign 0.08
IGL01109:Anapc4 APN 5 53,005,970 (GRCm39) missense probably damaging 1.00
IGL01657:Anapc4 APN 5 53,021,968 (GRCm39) nonsense probably null
IGL02692:Anapc4 APN 5 53,021,871 (GRCm39) missense probably damaging 0.98
IGL02734:Anapc4 APN 5 53,018,633 (GRCm39) missense probably benign 0.04
IGL03089:Anapc4 APN 5 53,023,740 (GRCm39) missense probably benign 0.32
IGL03096:Anapc4 APN 5 53,023,271 (GRCm39) missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 53,021,868 (GRCm39) missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52,997,075 (GRCm39) missense probably benign 0.00
R0331:Anapc4 UTSW 5 53,012,984 (GRCm39) splice site probably benign
R0511:Anapc4 UTSW 5 52,999,359 (GRCm39) unclassified probably benign
R0624:Anapc4 UTSW 5 53,002,761 (GRCm39) splice site probably benign
R0919:Anapc4 UTSW 5 53,012,979 (GRCm39) missense probably benign 0.18
R1935:Anapc4 UTSW 5 52,997,010 (GRCm39) missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52,997,010 (GRCm39) missense probably damaging 0.99
R1942:Anapc4 UTSW 5 53,004,056 (GRCm39) missense probably benign 0.30
R1953:Anapc4 UTSW 5 52,997,030 (GRCm39) missense probably damaging 1.00
R1954:Anapc4 UTSW 5 53,003,967 (GRCm39) intron probably benign
R2341:Anapc4 UTSW 5 52,999,279 (GRCm39) unclassified probably benign
R3696:Anapc4 UTSW 5 53,019,351 (GRCm39) missense probably null 0.01
R4506:Anapc4 UTSW 5 52,993,072 (GRCm39) missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52,999,060 (GRCm39) missense probably benign 0.00
R5234:Anapc4 UTSW 5 53,006,118 (GRCm39) missense probably damaging 1.00
R5256:Anapc4 UTSW 5 53,020,936 (GRCm39) missense probably benign
R5310:Anapc4 UTSW 5 53,016,501 (GRCm39) missense probably benign 0.00
R5401:Anapc4 UTSW 5 53,020,991 (GRCm39) missense probably benign 0.01
R5409:Anapc4 UTSW 5 53,005,941 (GRCm39) missense probably damaging 0.98
R5525:Anapc4 UTSW 5 53,014,151 (GRCm39) missense probably damaging 1.00
R5575:Anapc4 UTSW 5 53,013,213 (GRCm39) missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52,999,076 (GRCm39) nonsense probably null
R5695:Anapc4 UTSW 5 53,019,581 (GRCm39) missense probably benign 0.00
R5955:Anapc4 UTSW 5 53,023,288 (GRCm39) missense probably benign 0.01
R5974:Anapc4 UTSW 5 53,002,742 (GRCm39) missense probably damaging 1.00
R6458:Anapc4 UTSW 5 53,021,895 (GRCm39) missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 53,000,898 (GRCm39) missense probably damaging 0.98
R6633:Anapc4 UTSW 5 53,023,288 (GRCm39) missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 53,006,170 (GRCm39) missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52,993,093 (GRCm39) missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 53,019,577 (GRCm39) missense probably benign
R7327:Anapc4 UTSW 5 53,002,672 (GRCm39) missense probably damaging 0.99
R7442:Anapc4 UTSW 5 53,014,543 (GRCm39) missense probably benign 0.08
R7837:Anapc4 UTSW 5 53,016,550 (GRCm39) critical splice donor site probably null
R8382:Anapc4 UTSW 5 53,016,277 (GRCm39) splice site probably null
R8840:Anapc4 UTSW 5 53,016,473 (GRCm39) missense probably damaging 0.98
R8914:Anapc4 UTSW 5 53,000,843 (GRCm39) nonsense probably null
R8972:Anapc4 UTSW 5 53,007,884 (GRCm39) missense possibly damaging 0.88
R9037:Anapc4 UTSW 5 53,021,843 (GRCm39) missense probably benign 0.16
R9211:Anapc4 UTSW 5 53,007,994 (GRCm39) missense possibly damaging 0.74
R9269:Anapc4 UTSW 5 53,018,620 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCTAGCCGTTGATGTCAGG -3'
(R):5'- AGGATAACAGGAAAGCCTCTTG -3'

Sequencing Primer
(F):5'- CAGGTTTTTAGAGCTGTGAATGAAC -3'
(R):5'- TCTTGCTCAATGAGGCCG -3'
Posted On 2022-03-25