Mutagenetix > Incidental Mutation

Incidental Mutation 'R9294:Anapc4'

704447

Institutional Source

Beutler Lab

Gene Symbol

Anapc4

Ensembl Gene

ENSMUSG00000029176

Gene Name

anaphase promoting complex subunit 4

Synonyms

2610306D21Rik, D5Ertd249e, APC4

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9294 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52834012-52867797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52864525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 650 (T650A)

Ref Sequence

ENSEMBL: ENSMUSP00000031072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]

AlphaFold

Q91W96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031072
AA Change: T650A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: T650A

Domain	Start	End	E-Value	Type
Pfam:ANAPC4_WD40	10	57	9.1e-18	PFAM
low complexity region	137	147	N/A	INTRINSIC
Pfam:ANAPC4	232	431	3.7e-61	PFAM
low complexity region	747	763	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144574

SMART Domains

Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

Domain	Start	End	E-Value	Type
Pfam:Apc4_WD40	10	57	4e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	G	18: 38,261,076	L442R	probably damaging	Het
1700067K01Rik	A	G	8: 84,003,379	Y165C	probably damaging	Het
2410089E03Rik	T	C	15: 8,203,327	V1110A	probably benign	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4930452B06Rik	A	G	14: 8,578,361	I127T	possibly damaging	Het
Abcb11	T	A	2: 69,265,496	K833N	possibly damaging	Het
Abcb1a	T	A	5: 8,686,171	M188K	probably benign	Het
Akap1	A	T	11: 88,837,140	V672D	probably damaging	Het
Ash1l	C	A	3: 88,982,990	S725R	possibly damaging	Het
Axdnd1	T	A	1: 156,420,347	K28*	probably null	Het
C8b	C	A	4: 104,786,995	H286Q	probably benign	Het
Cacna2d1	A	G	5: 16,012,398	K34E	probably damaging	Het
Ccdc14	T	A	16: 34,697,358	H154Q	probably damaging	Het
Ccdc184	A	G	15: 98,168,512	D66G	probably damaging	Het
Ccdc62	A	G	5: 123,954,709	I586V	possibly damaging	Het
Chadl	A	T	15: 81,694,490	C313S	probably damaging	Het
Clec14a	C	A	12: 58,268,750	A29S	probably damaging	Het
Col26a1	C	T	5: 136,757,754	G161D	probably benign	Het
Ctbp2	A	G	7: 133,014,232	S325P	probably damaging	Het
Dcaf13	A	G	15: 39,130,292	D260G	possibly damaging	Het
Dhx37	G	A	5: 125,422,672	P575L	probably benign	Het
Dnajc6	T	C	4: 101,550,857		probably null	Het
Eapp	T	C	12: 54,690,276	T145A	unknown	Het
Efcab5	A	G	11: 77,121,238	M730T	probably benign	Het
Eif4g3	T	A	4: 138,190,657	D1305E	probably damaging	Het
Endou	A	T	15: 97,712,065	V450E	probably benign	Het
F10	A	T	8: 13,048,177	K127*	probably null	Het
Fbxw21	A	G	9: 109,143,762	F368S	probably damaging	Het
Fezf1	A	T	6: 23,245,798	L456Q	possibly damaging	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Fyco1	A	C	9: 123,794,813	C1384G	probably damaging	Het
Galnt6	G	T	15: 100,704,151	S258R	possibly damaging	Het
Gemin5	A	G	11: 58,137,748	V882A	probably benign	Het
Gm10750	A	G	2: 149,016,187	L48P	unknown	Het
Gm11639	A	G	11: 104,831,300	I1913V	probably benign	Het
Gm16503	T	A	4: 147,541,114	F22I	unknown	Het
Hdac10	A	G	15: 89,126,277	C281R	probably damaging	Het
Hikeshi	T	C	7: 89,935,760	S79G	probably damaging	Het
Ifitm2	AG	A	7: 140,955,901		probably null	Het
Itpr3	A	G	17: 27,111,217	E1603G	probably damaging	Het
Lrrc37a	A	T	11: 103,504,533	V22E	probably benign	Het
Man1a	C	T	10: 53,933,491		probably null	Het
Mdga1	A	G	17: 29,839,897	L5P	probably damaging	Het
Mettl7a1	A	G	15: 100,313,133	E213G	probably damaging	Het
Mup6	A	G	4: 60,004,838	I76M	probably benign	Het
Nbea	A	T	3: 56,091,092	M98K	probably benign	Het
Nckap1l	A	G	15: 103,473,539	E454G	probably damaging	Het
Notch3	A	T	17: 32,143,691	L1320Q	probably benign	Het
Nrn1	A	T	13: 36,726,674	L128H	probably damaging	Het
Numa1	T	C	7: 101,995,416	S200P	possibly damaging	Het
Numa1	A	G	7: 102,012,796	D1898G	probably damaging	Het
Olfr1124	G	A	2: 87,434,666	A60T	probably benign	Het
Olfr152	A	C	2: 87,782,523		probably null	Het
Olfr366	T	C	2: 37,220,110	I207T	possibly damaging	Het
Olfr700	A	T	7: 106,806,398	S21R	possibly damaging	Het
P2ry6	A	T	7: 100,938,926	Y75*	probably null	Het
Pbrm1	T	A	14: 31,084,803	C1062*	probably null	Het
Pcdh15	A	G	10: 74,643,728	E557G	unknown	Het
Pcdh7	T	C	5: 57,721,335	L744P	probably benign	Het
Plekhg3	A	T	12: 76,562,278	I142L	possibly damaging	Het
Plk4	C	T	3: 40,811,891	H695Y	probably damaging	Het
Pms1	T	C	1: 53,208,057	H243R	probably benign	Het
Prdm14	T	C	1: 13,122,483	D344G	possibly damaging	Het
R3hdml	A	G	2: 163,502,332	I214V	probably benign	Het
Rab11fip5	T	C	6: 85,348,710	N238S	probably benign	Het
Sacs	T	A	14: 61,240,319	Y732N	possibly damaging	Het
Scfd1	T	A	12: 51,393,866	M187K	possibly damaging	Het
Serpina1d	A	G	12: 103,767,998	C16R	probably damaging	Het
Slc2a12	T	C	10: 22,665,095	I283T	possibly damaging	Het
Smarca5	A	G	8: 80,719,803	Y423H	probably damaging	Het
Srrm3	C	A	5: 135,868,261	A366E	unknown	Het
St7	A	T	6: 17,844,914	K134*	probably null	Het
St8sia5	T	G	18: 77,254,829	C412G	probably damaging	Het
Tanc2	A	T	11: 105,886,458	I821F	probably damaging	Het
Tbrg4	A	G	11: 6,624,204	M6T	probably benign	Het
Tcf20	A	T	15: 82,852,696	I1518N	probably benign	Het
Tctn3	A	G	19: 40,607,276	V355A	probably benign	Het
Tenm2	A	T	11: 36,024,500	F2070Y	probably damaging	Het
Tex2	A	G	11: 106,568,535	V23A	probably damaging	Het
Thrsp	C	G	7: 97,417,074	E144Q	probably damaging	Het
Top2a	A	C	11: 99,001,078	S1114A	probably benign	Het
Tpm1	A	G	9: 67,029,716	Y267H	probably benign	Het
Txndc2	G	T	17: 65,639,024	P53T	unknown	Het
Ugt2b36	A	T	5: 87,081,017	I389N	probably damaging	Het
Virma	C	T	4: 11,513,507	R454*	probably null	Het
Vwa3b	T	A	1: 37,035,801	H16Q	probably damaging	Het
Zbp1	A	G	2: 173,210,643	M240T	possibly damaging	Het

Other mutations in Anapc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Anapc4	APN	5	52857211	missense	probably damaging	0.98
IGL01066:Anapc4	APN	5	52857209	missense	probably benign	0.08
IGL01109:Anapc4	APN	5	52848628	missense	probably damaging	1.00
IGL01657:Anapc4	APN	5	52864626	nonsense	probably null
IGL02692:Anapc4	APN	5	52864529	missense	probably damaging	0.98
IGL02734:Anapc4	APN	5	52861291	missense	probably benign	0.04
IGL03089:Anapc4	APN	5	52866398	missense	probably benign	0.32
IGL03096:Anapc4	APN	5	52865929	missense	possibly damaging	0.57
FR4304:Anapc4	UTSW	5	52864526	missense	probably damaging	1.00
IGL03048:Anapc4	UTSW	5	52839733	missense	probably benign	0.00
R0331:Anapc4	UTSW	5	52855642	splice site	probably benign
R0511:Anapc4	UTSW	5	52842017	unclassified	probably benign
R0624:Anapc4	UTSW	5	52845419	splice site	probably benign
R0919:Anapc4	UTSW	5	52855637	missense	probably benign	0.18
R1935:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1936:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1942:Anapc4	UTSW	5	52846714	missense	probably benign	0.30
R1953:Anapc4	UTSW	5	52839688	missense	probably damaging	1.00
R1954:Anapc4	UTSW	5	52846625	intron	probably benign
R2341:Anapc4	UTSW	5	52841937	unclassified	probably benign
R3696:Anapc4	UTSW	5	52862009	missense	probably null	0.01
R4506:Anapc4	UTSW	5	52835730	missense	possibly damaging	0.79
R4596:Anapc4	UTSW	5	52841718	missense	probably benign	0.00
R5234:Anapc4	UTSW	5	52848776	missense	probably damaging	1.00
R5256:Anapc4	UTSW	5	52863594	missense	probably benign
R5310:Anapc4	UTSW	5	52859159	missense	probably benign	0.00
R5401:Anapc4	UTSW	5	52863649	missense	probably benign	0.01
R5409:Anapc4	UTSW	5	52848599	missense	probably damaging	0.98
R5525:Anapc4	UTSW	5	52856809	missense	probably damaging	1.00
R5575:Anapc4	UTSW	5	52855871	missense	probably damaging	1.00
R5604:Anapc4	UTSW	5	52841734	nonsense	probably null
R5695:Anapc4	UTSW	5	52862239	missense	probably benign	0.00
R5955:Anapc4	UTSW	5	52865946	missense	probably benign	0.01
R5974:Anapc4	UTSW	5	52845400	missense	probably damaging	1.00
R6458:Anapc4	UTSW	5	52864553	missense	possibly damaging	0.80
R6537:Anapc4	UTSW	5	52843556	missense	probably damaging	0.98
R6633:Anapc4	UTSW	5	52865946	missense	possibly damaging	0.85
R6860:Anapc4	UTSW	5	52848828	missense	probably damaging	1.00
R6965:Anapc4	UTSW	5	52835751	missense	possibly damaging	0.89
R7067:Anapc4	UTSW	5	52862235	missense	probably benign
R7327:Anapc4	UTSW	5	52845330	missense	probably damaging	0.99
R7442:Anapc4	UTSW	5	52857201	missense	probably benign	0.08
R7837:Anapc4	UTSW	5	52859208	critical splice donor site	probably null
R8382:Anapc4	UTSW	5	52858935	splice site	probably null
R8840:Anapc4	UTSW	5	52859131	missense	probably damaging	0.98
R8914:Anapc4	UTSW	5	52843501	nonsense	probably null
R8972:Anapc4	UTSW	5	52850542	missense	possibly damaging	0.88
R9037:Anapc4	UTSW	5	52864501	missense	probably benign	0.16
R9211:Anapc4	UTSW	5	52850652	missense	possibly damaging	0.74
R9269:Anapc4	UTSW	5	52861278	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GTCTAGCCGTTGATGTCAGG -3'
(R):5'- AGGATAACAGGAAAGCCTCTTG -3'

Sequencing Primer
(F):5'- CAGGTTTTTAGAGCTGTGAATGAAC -3'
(R):5'- TCTTGCTCAATGAGGCCG -3'

Posted On

2022-03-25