Incidental Mutation 'R9294:F10'
ID 704466
Institutional Source Beutler Lab
Gene Symbol F10
Ensembl Gene ENSMUSG00000031444
Gene Name coagulation factor X
Synonyms AI194738, Cf10, fX
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13037308-13056676 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 13048177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 127 (K127*)
Ref Sequence ENSEMBL: ENSMUSP00000117312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000123768] [ENSMUST00000128418] [ENSMUST00000152034]
AlphaFold O88947
Predicted Effect probably null
Transcript: ENSMUST00000033821
AA Change: K139*
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444
AA Change: K139*

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063820
AA Change: K127*
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444
AA Change: K127*

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123768
SMART Domains Protein: ENSMUSP00000116984
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF 89 119 2.25e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128418
AA Change: K127*
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444
AA Change: K127*

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152034
AA Change: K127*
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444
AA Change: K127*

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes factor X, a component of both the intrinsic and extrinsic blood coagulation pathways. The encoded protein is a zymogen that undergoes further processing in a vitamin K-dependent manner to generate mature factor X, a heterodimer comprised of disulfide-linked heavy and light chains. The mature factor X is proteolytically activated either by factor IXa (intrinsic pathway) or factor VIIa (extrinsic pathway) to form factor Xa serine endopeptidase. Activated factor Xa catalyzes the conversion of prothrombin to thrombin. A complete lack of the encoded protein is fatal to mice. A severe deficiency of the encoded protein in mice causes age-dependent iron deposition and cardiac fibrosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Most homozygous mice die from fatal bleeding events at embryonic and neonatal stages, with the remaining homozygous mice dying before weaning stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in F10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:F10 APN 8 13055686 missense probably damaging 1.00
IGL01296:F10 APN 8 13055383 missense possibly damaging 0.49
IGL02010:F10 APN 8 13048292 missense probably damaging 0.97
IGL02707:F10 APN 8 13048252 missense probably damaging 1.00
IGL02716:F10 APN 8 13048177 nonsense probably null
IGL03354:F10 APN 8 13045089 missense probably benign 0.00
ju UTSW 8 13055698 missense probably damaging 1.00
PIT4494001:F10 UTSW 8 13053423 missense probably damaging 1.00
R0243:F10 UTSW 8 13048196 missense probably damaging 1.00
R0321:F10 UTSW 8 13053413 missense possibly damaging 0.95
R0416:F10 UTSW 8 13055448 missense probably damaging 1.00
R0421:F10 UTSW 8 13045097 missense probably benign 0.05
R0545:F10 UTSW 8 13048249 missense probably damaging 1.00
R1630:F10 UTSW 8 13055551 missense probably benign 0.00
R1732:F10 UTSW 8 13050764 missense probably damaging 1.00
R1956:F10 UTSW 8 13055422 missense probably damaging 1.00
R4130:F10 UTSW 8 13055584 missense possibly damaging 0.94
R4700:F10 UTSW 8 13039621 missense possibly damaging 0.93
R4989:F10 UTSW 8 13055698 missense probably damaging 1.00
R5133:F10 UTSW 8 13055698 missense probably damaging 1.00
R5134:F10 UTSW 8 13055698 missense probably damaging 1.00
R6826:F10 UTSW 8 13046165 splice site probably null
R7601:F10 UTSW 8 13050781 missense probably benign 0.26
R8164:F10 UTSW 8 13050781 missense probably benign 0.26
R8936:F10 UTSW 8 13045086 missense probably damaging 1.00
R9165:F10 UTSW 8 13039564 missense probably benign 0.00
R9260:F10 UTSW 8 13055638 missense probably damaging 1.00
X0024:F10 UTSW 8 13055859 missense probably benign
Z1177:F10 UTSW 8 13037845 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCAAACGTCCCTCCCATG -3'
(R):5'- CAGCACATGTGGCATCACTG -3'

Sequencing Primer
(F):5'- TATGGGGCTGGCATCTCAC -3'
(R):5'- GCCCACAGCAGTCTCCATG -3'
Posted On 2022-03-25