Mutagenetix > Incidental Mutation

Incidental Mutation 'R9294:Smarca5'

704467

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9294 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80719803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 423 (Y423H)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: Y423H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: Y423H

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	G	18: 38,261,076	L442R	probably damaging	Het
1700067K01Rik	A	G	8: 84,003,379	Y165C	probably damaging	Het
2410089E03Rik	T	C	15: 8,203,327	V1110A	probably benign	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4930452B06Rik	A	G	14: 8,578,361	I127T	possibly damaging	Het
Abcb11	T	A	2: 69,265,496	K833N	possibly damaging	Het
Abcb1a	T	A	5: 8,686,171	M188K	probably benign	Het
Akap1	A	T	11: 88,837,140	V672D	probably damaging	Het
Anapc4	A	G	5: 52,864,525	T650A	possibly damaging	Het
Ash1l	C	A	3: 88,982,990	S725R	possibly damaging	Het
Axdnd1	T	A	1: 156,420,347	K28*	probably null	Het
C8b	C	A	4: 104,786,995	H286Q	probably benign	Het
Cacna2d1	A	G	5: 16,012,398	K34E	probably damaging	Het
Ccdc14	T	A	16: 34,697,358	H154Q	probably damaging	Het
Ccdc184	A	G	15: 98,168,512	D66G	probably damaging	Het
Ccdc62	A	G	5: 123,954,709	I586V	possibly damaging	Het
Chadl	A	T	15: 81,694,490	C313S	probably damaging	Het
Clec14a	C	A	12: 58,268,750	A29S	probably damaging	Het
Col26a1	C	T	5: 136,757,754	G161D	probably benign	Het
Ctbp2	A	G	7: 133,014,232	S325P	probably damaging	Het
Dcaf13	A	G	15: 39,130,292	D260G	possibly damaging	Het
Dhx37	G	A	5: 125,422,672	P575L	probably benign	Het
Dnajc6	T	C	4: 101,550,857		probably null	Het
Eapp	T	C	12: 54,690,276	T145A	unknown	Het
Efcab5	A	G	11: 77,121,238	M730T	probably benign	Het
Eif4g3	T	A	4: 138,190,657	D1305E	probably damaging	Het
Endou	A	T	15: 97,712,065	V450E	probably benign	Het
F10	A	T	8: 13,048,177	K127*	probably null	Het
Fbxw21	A	G	9: 109,143,762	F368S	probably damaging	Het
Fezf1	A	T	6: 23,245,798	L456Q	possibly damaging	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Fyco1	A	C	9: 123,794,813	C1384G	probably damaging	Het
Galnt6	G	T	15: 100,704,151	S258R	possibly damaging	Het
Gemin5	A	G	11: 58,137,748	V882A	probably benign	Het
Gm10750	A	G	2: 149,016,187	L48P	unknown	Het
Gm11639	A	G	11: 104,831,300	I1913V	probably benign	Het
Gm16503	T	A	4: 147,541,114	F22I	unknown	Het
Hdac10	A	G	15: 89,126,277	C281R	probably damaging	Het
Hikeshi	T	C	7: 89,935,760	S79G	probably damaging	Het
Ifitm2	AG	A	7: 140,955,901		probably null	Het
Itpr3	A	G	17: 27,111,217	E1603G	probably damaging	Het
Lrrc37a	A	T	11: 103,504,533	V22E	probably benign	Het
Man1a	C	T	10: 53,933,491		probably null	Het
Mdga1	A	G	17: 29,839,897	L5P	probably damaging	Het
Mettl7a1	A	G	15: 100,313,133	E213G	probably damaging	Het
Mup6	A	G	4: 60,004,838	I76M	probably benign	Het
Nbea	A	T	3: 56,091,092	M98K	probably benign	Het
Nckap1l	A	G	15: 103,473,539	E454G	probably damaging	Het
Notch3	A	T	17: 32,143,691	L1320Q	probably benign	Het
Nrn1	A	T	13: 36,726,674	L128H	probably damaging	Het
Numa1	T	C	7: 101,995,416	S200P	possibly damaging	Het
Numa1	A	G	7: 102,012,796	D1898G	probably damaging	Het
Olfr1124	G	A	2: 87,434,666	A60T	probably benign	Het
Olfr152	A	C	2: 87,782,523		probably null	Het
Olfr366	T	C	2: 37,220,110	I207T	possibly damaging	Het
Olfr700	A	T	7: 106,806,398	S21R	possibly damaging	Het
P2ry6	A	T	7: 100,938,926	Y75*	probably null	Het
Pbrm1	T	A	14: 31,084,803	C1062*	probably null	Het
Pcdh15	A	G	10: 74,643,728	E557G	unknown	Het
Pcdh7	T	C	5: 57,721,335	L744P	probably benign	Het
Plekhg3	A	T	12: 76,562,278	I142L	possibly damaging	Het
Plk4	C	T	3: 40,811,891	H695Y	probably damaging	Het
Pms1	T	C	1: 53,208,057	H243R	probably benign	Het
Prdm14	T	C	1: 13,122,483	D344G	possibly damaging	Het
R3hdml	A	G	2: 163,502,332	I214V	probably benign	Het
Rab11fip5	T	C	6: 85,348,710	N238S	probably benign	Het
Sacs	T	A	14: 61,240,319	Y732N	possibly damaging	Het
Scfd1	T	A	12: 51,393,866	M187K	possibly damaging	Het
Serpina1d	A	G	12: 103,767,998	C16R	probably damaging	Het
Slc2a12	T	C	10: 22,665,095	I283T	possibly damaging	Het
Srrm3	C	A	5: 135,868,261	A366E	unknown	Het
St7	A	T	6: 17,844,914	K134*	probably null	Het
St8sia5	T	G	18: 77,254,829	C412G	probably damaging	Het
Tanc2	A	T	11: 105,886,458	I821F	probably damaging	Het
Tbrg4	A	G	11: 6,624,204	M6T	probably benign	Het
Tcf20	A	T	15: 82,852,696	I1518N	probably benign	Het
Tctn3	A	G	19: 40,607,276	V355A	probably benign	Het
Tenm2	A	T	11: 36,024,500	F2070Y	probably damaging	Het
Tex2	A	G	11: 106,568,535	V23A	probably damaging	Het
Thrsp	C	G	7: 97,417,074	E144Q	probably damaging	Het
Top2a	A	C	11: 99,001,078	S1114A	probably benign	Het
Tpm1	A	G	9: 67,029,716	Y267H	probably benign	Het
Txndc2	G	T	17: 65,639,024	P53T	unknown	Het
Ugt2b36	A	T	5: 87,081,017	I389N	probably damaging	Het
Virma	C	T	4: 11,513,507	R454*	probably null	Het
Vwa3b	T	A	1: 37,035,801	H16Q	probably damaging	Het
Zbp1	A	G	2: 173,210,643	M240T	possibly damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGCCACTGTTGGTAACTAGATG -3'
(R):5'- TGCATCATCACCACATAAGCTG -3'

Sequencing Primer
(F):5'- CCACTGTTGGTAACTAGATGCATATC -3'
(R):5'- TTGCTTTTGTATAAACATGGGAAAC -3'

Posted On

2022-03-25