Incidental Mutation 'R9294:Foxo3'
ID 704473
Institutional Source Beutler Lab
Gene Symbol Foxo3
Ensembl Gene ENSMUSG00000048756
Gene Name forkhead box O3
Synonyms FKHRL1, 2010203A17Rik, 1110048B16Rik, Foxo3a, Fkhr2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 42181841-42276755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42197025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 499 (V499M)
Ref Sequence ENSEMBL: ENSMUSP00000050683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056974] [ENSMUST00000105502] [ENSMUST00000175881] [ENSMUST00000177542]
AlphaFold Q9WVH4
Predicted Effect probably damaging
Transcript: ENSMUST00000056974
AA Change: V499M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050683
Gene: ENSMUSG00000048756
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Pfam:FOXO_KIX_bdg 431 510 5.5e-36 PFAM
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Pfam:FOXO-TAD 603 644 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105502
AA Change: V499M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101141
Gene: ENSMUSG00000048756
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175881
AA Change: V499M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135380
Gene: ENSMUSG00000048756
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 107 146 N/A INTRINSIC
FH 154 244 1.3e-45 SMART
low complexity region 266 276 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177542
SMART Domains Protein: ENSMUSP00000135355
Gene: ENSMUSG00000048756

DomainStartEndE-ValueType
SCOP:d1e17a_ 1 21 3e-4 SMART
Blast:FH 1 28 4e-10 BLAST
PDB:3COA|F 1 43 1e-18 PDB
low complexity region 47 57 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. This gene likely functions as a trigger for apoptosis through expression of genes necessary for cell death. Translocation of this gene with the MLL gene is associated with secondary acute leukemia. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of the locus results in an ovarian defect involving follicular growth activation and leads progressively to female sterility. For some alleles defects in immune system function and hematopoiesis have also been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Foxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0486:Foxo3 UTSW 10 42197481 missense probably damaging 1.00
R1558:Foxo3 UTSW 10 42197072 missense probably damaging 0.99
R1819:Foxo3 UTSW 10 42197611 missense probably benign 0.12
R1970:Foxo3 UTSW 10 42197262 missense probably benign 0.24
R1971:Foxo3 UTSW 10 42197262 missense probably benign 0.24
R2447:Foxo3 UTSW 10 42197820 missense probably benign
R3016:Foxo3 UTSW 10 42197356 missense probably benign 0.00
R4719:Foxo3 UTSW 10 42197778 missense probably damaging 1.00
R4926:Foxo3 UTSW 10 42197024 missense probably damaging 0.98
R5908:Foxo3 UTSW 10 42196587 missense probably benign 0.03
R6053:Foxo3 UTSW 10 42197214 missense probably benign 0.26
R7142:Foxo3 UTSW 10 42274595 splice site probably null
R7328:Foxo3 UTSW 10 42197262 missense probably benign 0.14
R7386:Foxo3 UTSW 10 42197360 missense probably benign 0.08
R7889:Foxo3 UTSW 10 42275027 missense probably benign 0.41
R7896:Foxo3 UTSW 10 42197736 missense possibly damaging 0.47
R7920:Foxo3 UTSW 10 42197769 missense possibly damaging 0.47
R8212:Foxo3 UTSW 10 42196995 missense possibly damaging 0.54
R8560:Foxo3 UTSW 10 42275282 missense possibly damaging 0.95
R9293:Foxo3 UTSW 10 42197025 missense probably damaging 0.99
R9491:Foxo3 UTSW 10 42197025 missense probably damaging 0.99
R9502:Foxo3 UTSW 10 42197025 missense probably damaging 0.99
R9567:Foxo3 UTSW 10 42197025 missense probably damaging 0.99
R9584:Foxo3 UTSW 10 42197025 missense probably damaging 0.99
Z1176:Foxo3 UTSW 10 42275265 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGTCACTCAAGCCCATGTTG -3'
(R):5'- CCTTCAACAGTACCGTGTTTGG -3'

Sequencing Primer
(F):5'- TCAAGCCCATGTTGCTGACAG -3'
(R):5'- AACAGTACCGTGTTTGGACCTTC -3'
Posted On 2022-03-25