Incidental Mutation 'R9294:Pcdh15'
ID 704475
Institutional Source Beutler Lab
Gene Symbol Pcdh15
Ensembl Gene ENSMUSG00000052613
Gene Name protocadherin 15
Synonyms Gm9815, nmf19, Ush1f
Accession Numbers

Genbank: NM_023115; Ensembl: ENSMUST00000105425

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 73099342-74649737 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74643728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 557 (E557G)
Ref Sequence ENSEMBL: ENSMUSP00000115399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124046] [ENSMUST00000125517] [ENSMUST00000131724] [ENSMUST00000144302] [ENSMUST00000146682] [ENSMUST00000149977] [ENSMUST00000151116] [ENSMUST00000152655] [ENSMUST00000152819] [ENSMUST00000155701] [ENSMUST00000177107] [ENSMUST00000191709] [ENSMUST00000191854] [ENSMUST00000193174] [ENSMUST00000193739] [ENSMUST00000195531]
AlphaFold Q99PJ1
Predicted Effect probably benign
Transcript: ENSMUST00000124046
SMART Domains Protein: ENSMUSP00000121130
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
CA 30 118 7.87e-9 SMART
CA 142 224 4.88e-14 SMART
CA 249 326 4.65e-20 SMART
CA 350 428 1.93e-26 SMART
CA 452 535 5.69e-15 SMART
CA 559 645 6.85e-9 SMART
CA 666 753 3.09e-16 SMART
CA 777 861 4.49e-4 SMART
transmembrane domain 986 1008 N/A INTRINSIC
low complexity region 1029 1056 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125517
AA Change: E557G
SMART Domains Protein: ENSMUSP00000115399
Gene: ENSMUSG00000052613
AA Change: E557G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
low complexity region 430 468 N/A INTRINSIC
low complexity region 521 584 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131724
SMART Domains Protein: ENSMUSP00000122466
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144302
SMART Domains Protein: ENSMUSP00000122606
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
low complexity region 313 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146682
SMART Domains Protein: ENSMUSP00000134863
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149977
SMART Domains Protein: ENSMUSP00000118833
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151116
AA Change: E1628G
SMART Domains Protein: ENSMUSP00000119662
Gene: ENSMUSG00000052613
AA Change: E1628G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 519 7.87e-9 SMART
CA 543 625 4.88e-14 SMART
CA 650 727 4.65e-20 SMART
CA 751 829 1.93e-26 SMART
CA 853 936 5.69e-15 SMART
CA 960 1046 6.85e-9 SMART
CA 1067 1154 3.09e-16 SMART
CA 1178 1262 4.49e-4 SMART
transmembrane domain 1387 1409 N/A INTRINSIC
low complexity region 1430 1457 N/A INTRINSIC
low complexity region 1489 1519 N/A INTRINSIC
low complexity region 1521 1539 N/A INTRINSIC
low complexity region 1592 1655 N/A INTRINSIC
low complexity region 1681 1712 N/A INTRINSIC
low complexity region 1728 1756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152655
AA Change: E819G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118201
Gene: ENSMUSG00000052613
AA Change: E819G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 726 3.4e-6 SMART
low complexity region 783 846 N/A INTRINSIC
low complexity region 872 903 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152819
AA Change: E488G
SMART Domains Protein: ENSMUSP00000123647
Gene: ENSMUSG00000052613
AA Change: E488G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 363 1e-33 BLAST
low complexity region 364 399 N/A INTRINSIC
low complexity region 452 515 N/A INTRINSIC
low complexity region 541 572 N/A INTRINSIC
low complexity region 588 616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155701
SMART Domains Protein: ENSMUSP00000135495
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 330 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177107
SMART Domains Protein: ENSMUSP00000135501
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1482 1499 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191709
AA Change: E1619G
SMART Domains Protein: ENSMUSP00000142313
Gene: ENSMUSG00000052613
AA Change: E1619G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1480 1510 N/A INTRINSIC
low complexity region 1512 1530 N/A INTRINSIC
low complexity region 1583 1646 N/A INTRINSIC
low complexity region 1672 1703 N/A INTRINSIC
low complexity region 1719 1747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191854
SMART Domains Protein: ENSMUSP00000141973
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193174
AA Change: E1621G
SMART Domains Protein: ENSMUSP00000142238
Gene: ENSMUSG00000052613
AA Change: E1621G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 514 3.8e-11 SMART
CA 538 620 2.3e-16 SMART
CA 645 722 2.3e-22 SMART
CA 746 824 9.3e-29 SMART
CA 848 931 2.8e-17 SMART
CA 955 1041 3.3e-11 SMART
CA 1062 1149 1.5e-18 SMART
CA 1173 1257 2.3e-6 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1425 1452 N/A INTRINSIC
low complexity region 1482 1512 N/A INTRINSIC
low complexity region 1514 1532 N/A INTRINSIC
low complexity region 1585 1648 N/A INTRINSIC
low complexity region 1674 1705 N/A INTRINSIC
low complexity region 1721 1749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193739
SMART Domains Protein: ENSMUSP00000142173
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1420 1447 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195531
SMART Domains Protein: ENSMUSP00000141920
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 715 2.3e-22 SMART
CA 739 817 9.3e-29 SMART
CA 841 924 2.8e-17 SMART
CA 948 1034 3.3e-11 SMART
CA 1055 1142 1.5e-18 SMART
CA 1166 1250 2.3e-6 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1514 1531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygotes for severe mutations exhibit circling, head-tossing, hyperactivity, impaired swimming and profound deafness. Mice have defects in cochlea and degeneration of hair cells, spiral ganglion cells and saccular macula. Females are poor mothers. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Transgenic(1) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Pcdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pcdh15 APN 10 74185345 nonsense probably null
IGL00432:Pcdh15 APN 10 74291082 splice site probably benign
IGL00533:Pcdh15 APN 10 74502720 missense probably damaging 1.00
IGL00596:Pcdh15 APN 10 74630744 missense probably benign 0.00
IGL00930:Pcdh15 APN 10 74630698 missense probably benign 0.08
IGL00970:Pcdh15 APN 10 74379340 missense probably damaging 1.00
IGL01087:Pcdh15 APN 10 74342632 missense possibly damaging 0.90
IGL01763:Pcdh15 APN 10 74210461 missense probably benign 0.09
IGL01787:Pcdh15 APN 10 74450283 missense probably benign 0.25
IGL02070:Pcdh15 APN 10 74630868 missense probably benign 0.00
IGL02234:Pcdh15 APN 10 74631862 missense probably benign 0.02
IGL02268:Pcdh15 APN 10 74342672 missense probably damaging 1.00
IGL02280:Pcdh15 APN 10 74222463 missense probably damaging 1.00
IGL02363:Pcdh15 APN 10 74317086 missense probably damaging 0.98
IGL02420:Pcdh15 APN 10 74303106 missense probably damaging 0.98
IGL02749:Pcdh15 APN 10 74631068 missense probably benign 0.00
IGL02939:Pcdh15 APN 10 74504816 splice site probably benign
IGL02970:Pcdh15 APN 10 74290962 splice site probably benign
IGL03010:Pcdh15 APN 10 74385945 missense probably damaging 1.00
IGL03061:Pcdh15 APN 10 74317011 missense probably damaging 0.97
IGL03095:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03149:Pcdh15 APN 10 74630695 missense probably damaging 1.00
IGL03187:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03279:Pcdh15 APN 10 74317072 missense probably damaging 1.00
IGL03392:Pcdh15 APN 10 74624272 missense probably damaging 1.00
loop UTSW 10 74185378 missense probably damaging 1.00
mcduck UTSW 10 74626844 critical splice donor site probably null
spaz UTSW 10 74210425 missense probably damaging 1.00
sphere UTSW 10 74624284 missense probably damaging 1.00
squirm UTSW 10 large deletion
Tortilla UTSW 10 74379417 splice site probably null
1mM(1):Pcdh15 UTSW 10 74626137 intron probably benign
BB009:Pcdh15 UTSW 10 74645527 missense probably benign 0.18
BB019:Pcdh15 UTSW 10 74645527 missense probably benign 0.18
R0038:Pcdh15 UTSW 10 74643440 missense possibly damaging 0.95
R0103:Pcdh15 UTSW 10 74210425 missense probably damaging 1.00
R0110:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0111:Pcdh15 UTSW 10 74626819 nonsense probably null
R0119:Pcdh15 UTSW 10 74170575 missense probably damaging 1.00
R0131:Pcdh15 UTSW 10 74170608 missense probably null 1.00
R0445:Pcdh15 UTSW 10 74342549 missense probably damaging 1.00
R0464:Pcdh15 UTSW 10 74626844 critical splice donor site probably null
R0503:Pcdh15 UTSW 10 74210385 missense probably damaging 1.00
R0507:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0510:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0742:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0790:Pcdh15 UTSW 10 74631053 missense probably benign 0.01
R0829:Pcdh15 UTSW 10 74502766 missense probably damaging 1.00
R0839:Pcdh15 UTSW 10 74626782 missense probably null 1.00
R0882:Pcdh15 UTSW 10 74342656 missense probably damaging 1.00
R0894:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R0944:Pcdh15 UTSW 10 74210470 missense probably damaging 0.99
R1081:Pcdh15 UTSW 10 74450313 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1484:Pcdh15 UTSW 10 74291001 missense probably damaging 1.00
R1521:Pcdh15 UTSW 10 74594191 missense probably damaging 1.00
R1694:Pcdh15 UTSW 10 74594163 missense probably damaging 1.00
R1795:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R2021:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2022:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2023:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2076:Pcdh15 UTSW 10 74342647 missense probably damaging 1.00
R2199:Pcdh15 UTSW 10 74170509 missense probably damaging 1.00
R2510:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R2511:Pcdh15 UTSW 10 74645996 missense possibly damaging 0.94
R3418:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3419:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3433:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R3619:Pcdh15 UTSW 10 74643395 missense probably benign 0.19
R3723:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3724:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3778:Pcdh15 UTSW 10 73947151 splice site probably null
R3851:Pcdh15 UTSW 10 74631686 missense probably damaging 0.97
R4175:Pcdh15 UTSW 10 74631997 intron probably benign
R4261:Pcdh15 UTSW 10 74645680 missense probably damaging 1.00
R4385:Pcdh15 UTSW 10 74550490 missense probably damaging 1.00
R4585:Pcdh15 UTSW 10 74624284 missense probably damaging 1.00
R4602:Pcdh15 UTSW 10 74594214 missense probably damaging 1.00
R4639:Pcdh15 UTSW 10 74643607 missense probably benign 0.00
R4703:Pcdh15 UTSW 10 74450163 missense probably damaging 1.00
R4819:Pcdh15 UTSW 10 74324389 missense probably damaging 1.00
R4906:Pcdh15 UTSW 10 74504793 nonsense probably null
R4961:Pcdh15 UTSW 10 74379417 splice site probably null
R5018:Pcdh15 UTSW 10 74643775 missense possibly damaging 0.68
R5125:Pcdh15 UTSW 10 74584080 missense probably damaging 0.98
R5225:Pcdh15 UTSW 10 74303154 missense probably damaging 1.00
R5259:Pcdh15 UTSW 10 74396372 missense possibly damaging 0.67
R5279:Pcdh15 UTSW 10 74594183 missense probably damaging 1.00
R5395:Pcdh15 UTSW 10 74185287 missense probably damaging 1.00
R5458:Pcdh15 UTSW 10 74504779 missense probably damaging 1.00
R5617:Pcdh15 UTSW 10 74635672 intron probably benign
R5665:Pcdh15 UTSW 10 74626788 missense probably damaging 1.00
R5770:Pcdh15 UTSW 10 74185345 nonsense probably null
R5805:Pcdh15 UTSW 10 74230259 missense probably damaging 1.00
R5914:Pcdh15 UTSW 10 74630936 missense probably benign 0.42
R5988:Pcdh15 UTSW 10 74379357 missense probably benign 0.05
R6133:Pcdh15 UTSW 10 74645973 splice site probably null
R6189:Pcdh15 UTSW 10 74342651 missense probably null 1.00
R6414:Pcdh15 UTSW 10 74185426 missense probably damaging 1.00
R6536:Pcdh15 UTSW 10 74631389 missense probably damaging 1.00
R6612:Pcdh15 UTSW 10 74185378 missense probably damaging 1.00
R6711:Pcdh15 UTSW 10 74642387 missense possibly damaging 0.83
R6793:Pcdh15 UTSW 10 74631139 missense probably damaging 1.00
R6841:Pcdh15 UTSW 10 74450220 missense probably damaging 1.00
R6845:Pcdh15 UTSW 10 74630633 missense probably benign
R6915:Pcdh15 UTSW 10 74643809 missense probably benign 0.16
R6954:Pcdh15 UTSW 10 74645989 missense possibly damaging 0.92
R6970:Pcdh15 UTSW 10 74502687 missense probably damaging 0.98
R7018:Pcdh15 UTSW 10 74466354 missense probably damaging 1.00
R7064:Pcdh15 UTSW 10 74630614 missense possibly damaging 0.67
R7079:Pcdh15 UTSW 10 74317125 missense probably benign 0.21
R7172:Pcdh15 UTSW 10 74502765 missense probably damaging 1.00
R7220:Pcdh15 UTSW 10 74342609 missense possibly damaging 0.64
R7237:Pcdh15 UTSW 10 74584191 missense possibly damaging 0.88
R7266:Pcdh15 UTSW 10 74379390 nonsense probably null
R7276:Pcdh15 UTSW 10 74324392 missense probably benign 0.25
R7359:Pcdh15 UTSW 10 74584216 missense probably damaging 0.99
R7396:Pcdh15 UTSW 10 74630690 missense probably benign 0.17
R7421:Pcdh15 UTSW 10 74454065 missense possibly damaging 0.90
R7424:Pcdh15 UTSW 10 74506485 missense probably benign 0.09
R7463:Pcdh15 UTSW 10 74631770 missense possibly damaging 0.66
R7469:Pcdh15 UTSW 10 74645980 missense probably benign
R7512:Pcdh15 UTSW 10 74641382 missense possibly damaging 0.81
R7767:Pcdh15 UTSW 10 74486256 missense probably benign 0.07
R7830:Pcdh15 UTSW 10 74385901 missense probably damaging 1.00
R7890:Pcdh15 UTSW 10 74642314 missense probably damaging 1.00
R7897:Pcdh15 UTSW 10 74453995 missense probably damaging 1.00
R7908:Pcdh15 UTSW 10 74643582 missense probably benign 0.04
R7932:Pcdh15 UTSW 10 74645527 missense probably benign 0.18
R7940:Pcdh15 UTSW 10 74594190 missense probably damaging 1.00
R8230:Pcdh15 UTSW 10 74355875 missense probably damaging 1.00
R8307:Pcdh15 UTSW 10 74506475 nonsense probably null
R8382:Pcdh15 UTSW 10 74643395 missense probably benign 0.19
R8397:Pcdh15 UTSW 10 74291033 missense probably damaging 1.00
R8498:Pcdh15 UTSW 10 74482142 missense probably damaging 1.00
R8692:Pcdh15 UTSW 10 74453973 missense possibly damaging 0.63
R8797:Pcdh15 UTSW 10 74584146 missense probably damaging 1.00
R9020:Pcdh15 UTSW 10 74645611 missense probably benign 0.01
R9033:Pcdh15 UTSW 10 74466306 missense probably damaging 1.00
R9056:Pcdh15 UTSW 10 74385899 missense probably damaging 1.00
R9177:Pcdh15 UTSW 10 74643623 missense probably benign 0.13
R9191:Pcdh15 UTSW 10 74326149 missense probably benign 0.38
R9268:Pcdh15 UTSW 10 74643623 missense probably benign 0.13
R9387:Pcdh15 UTSW 10 74230360 missense probably damaging 0.98
R9409:Pcdh15 UTSW 10 74324358 missense probably damaging 0.98
R9410:Pcdh15 UTSW 10 74645831 frame shift probably null
R9412:Pcdh15 UTSW 10 74645831 frame shift probably null
R9432:Pcdh15 UTSW 10 74624338 missense probably damaging 1.00
R9444:Pcdh15 UTSW 10 74642344 missense probably damaging 1.00
R9579:Pcdh15 UTSW 10 74621285 missense possibly damaging 0.89
RF020:Pcdh15 UTSW 10 74185410 missense probably damaging 1.00
Z1176:Pcdh15 UTSW 10 74630701 missense probably benign 0.00
Z1177:Pcdh15 UTSW 10 74504800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGCTGAGAAAAGAGGCATTG -3'
(R):5'- ATGGGAGCTGCTTCGCTTTC -3'

Sequencing Primer
(F):5'- AGGCATTGACCTTGAGGGC -3'
(R):5'- CCTCTAGTGGGGGCTCTTC -3'
Posted On 2022-03-25