Incidental Mutation 'R9294:Top2a'
ID 704481
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Name topoisomerase (DNA) II alpha
Synonyms Top-2, DNA Topoisomerase II alpha
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 98992943-99024189 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 99001078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1114 (S1114A)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
AlphaFold Q01320
Predicted Effect probably benign
Transcript: ENSMUST00000068031
AA Change: S1114A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: S1114A

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R8122:Top2a UTSW 11 98999167 missense probably benign
R8260:Top2a UTSW 11 99000769 missense probably null 0.87
R8504:Top2a UTSW 11 99014741 missense probably benign
R8550:Top2a UTSW 11 98995918 missense probably benign
R8558:Top2a UTSW 11 99021723 missense probably damaging 1.00
R8693:Top2a UTSW 11 99010042 missense probably damaging 1.00
R8851:Top2a UTSW 11 99009851 missense probably damaging 1.00
R9143:Top2a UTSW 11 99009879 missense probably benign 0.14
R9240:Top2a UTSW 11 99010542 nonsense probably null
R9301:Top2a UTSW 11 99006964 missense probably damaging 0.99
R9383:Top2a UTSW 11 99011058 nonsense probably null
R9450:Top2a UTSW 11 99003608 missense possibly damaging 0.73
R9515:Top2a UTSW 11 99012144 missense probably damaging 0.99
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCAGAACCCAGTTAAATTTCCC -3'
(R):5'- TTGCTAAGCTCCGAGGATGTC -3'

Sequencing Primer
(F):5'- CCCAGTTAAATTTCCCACCAGG -3'
(R):5'- TGCTCTGGCACTCATCAGG -3'
Posted On 2022-03-25