Incidental Mutation 'R9294:Gm11639'
ID 704483
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Name predicted gene 11639
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 104685707-105117394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104831300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1913 (I1913V)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: I1913V

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 splice site probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 splice site probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7682:Gm11639 UTSW 11 104964348 splice site probably null
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7936:Gm11639 UTSW 11 104999698 missense possibly damaging 0.89
R7936:Gm11639 UTSW 11 105046559 critical splice donor site probably null
R7959:Gm11639 UTSW 11 105042801 missense probably damaging 0.96
R8031:Gm11639 UTSW 11 104881469 missense possibly damaging 0.49
R8041:Gm11639 UTSW 11 104919479 missense unknown
R8054:Gm11639 UTSW 11 104730400 missense probably benign 0.07
R8056:Gm11639 UTSW 11 104909070 missense probably damaging 0.98
R8088:Gm11639 UTSW 11 104998246 missense probably benign 0.10
R8112:Gm11639 UTSW 11 104950200 missense unknown
R8340:Gm11639 UTSW 11 104986030 missense unknown
R8405:Gm11639 UTSW 11 104721198 missense probably benign 0.02
R8413:Gm11639 UTSW 11 104920309 missense unknown
R8472:Gm11639 UTSW 11 104818637 missense probably benign 0.07
R8549:Gm11639 UTSW 11 104999695 missense probably damaging 0.99
R8699:Gm11639 UTSW 11 104781246 missense probably benign 0.03
R8711:Gm11639 UTSW 11 104852545 missense probably benign 0.03
R8732:Gm11639 UTSW 11 104804274 missense probably benign 0.03
R8745:Gm11639 UTSW 11 104858478 missense possibly damaging 0.57
R8806:Gm11639 UTSW 11 105037869 missense probably benign 0.07
R8810:Gm11639 UTSW 11 104914895 missense unknown
R8845:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R8870:Gm11639 UTSW 11 104900674 missense probably benign 0.07
R8872:Gm11639 UTSW 11 104870054 missense probably benign 0.19
R8879:Gm11639 UTSW 11 104690955 missense probably benign 0.03
R8924:Gm11639 UTSW 11 104915427 frame shift probably null
R8954:Gm11639 UTSW 11 105018699 critical splice donor site probably null
R8975:Gm11639 UTSW 11 105063589 missense probably benign 0.17
R8988:Gm11639 UTSW 11 105020526 missense probably benign 0.07
R8998:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R8999:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R9002:Gm11639 UTSW 11 105029996 missense probably damaging 0.99
R9012:Gm11639 UTSW 11 104820521 critical splice donor site probably null
R9036:Gm11639 UTSW 11 105036775 missense probably benign 0.03
R9037:Gm11639 UTSW 11 104912965 missense unknown
R9059:Gm11639 UTSW 11 104751863 missense possibly damaging 0.73
R9066:Gm11639 UTSW 11 104740862 intron probably benign
R9122:Gm11639 UTSW 11 104965779 missense unknown
R9125:Gm11639 UTSW 11 104845534 missense probably damaging 1.00
R9127:Gm11639 UTSW 11 104850581 missense probably benign 0.07
R9171:Gm11639 UTSW 11 104909882 missense probably benign 0.36
R9219:Gm11639 UTSW 11 104945865 missense unknown
R9224:Gm11639 UTSW 11 104770975 missense probably benign 0.07
R9235:Gm11639 UTSW 11 105017161 missense probably benign 0.19
R9318:Gm11639 UTSW 11 104965822 critical splice donor site probably null
R9322:Gm11639 UTSW 11 104874373 missense probably benign 0.36
R9361:Gm11639 UTSW 11 105005698 missense probably benign 0.03
R9408:Gm11639 UTSW 11 104730429 critical splice donor site probably null
R9434:Gm11639 UTSW 11 105009037 missense probably benign 0.24
R9477:Gm11639 UTSW 11 104945872 missense unknown
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense probably benign 0.29
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense probably benign 0.03
Z1177:Gm11639 UTSW 11 104924019 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCTGAAGGACCTTGCTTG -3'
(R):5'- CATATGATTACTAAGTGCCCAGC -3'

Sequencing Primer
(F):5'- CTTGGGGCATCTTTTTATGATGAC -3'
(R):5'- ACTGCTCTTCTGAAGGCCATGAG -3'
Posted On 2022-03-25