Mutagenetix > Incidental Mutation

Incidental Mutation 'R9294:Nrn1'

704491

Institutional Source

Beutler Lab

Gene Symbol

Nrn1

Ensembl Gene

ENSMUSG00000039114

Gene Name

neuritin 1

Synonyms

cpg15, 0710008J23Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R9294 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36725361-36735131 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36726674 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 128 (L128H)

Ref Sequence

ENSEMBL: ENSMUSP00000040900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037623] [ENSMUST00000122286] [ENSMUST00000223611] [ENSMUST00000224323] [ENSMUST00000224916] [ENSMUST00000224960]

AlphaFold

Q8CFV4

Predicted Effect

probably damaging
Transcript: ENSMUST00000037623
AA Change: L128H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000040900
Gene: ENSMUSG00000039114
AA Change: L128H

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:NRN1	31	120	1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122286
AA Change: L144H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113721
Gene: ENSMUSG00000039114
AA Change: L144H

Domain	Start	End	E-Value	Type
Pfam:NRN1	47	133	2.7e-42	PFAM
transmembrane domain	134	156	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223611
AA Change: L80H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224323
AA Change: L137H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000224916

Predicted Effect

probably damaging
Transcript: ENSMUST00000224960
AA Change: L128H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body length and body weight, delayed axonal, dendritic, and synaptic development, reduced dendritic spine maintenance leading to gradual spine loss, and impaired associative and spatial learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	G	18: 38,261,076	L442R	probably damaging	Het
1700067K01Rik	A	G	8: 84,003,379	Y165C	probably damaging	Het
2410089E03Rik	T	C	15: 8,203,327	V1110A	probably benign	Het
2810474O19Rik	T	A	6: 149,326,432	N325K	probably benign	Het
4930452B06Rik	A	G	14: 8,578,361	I127T	possibly damaging	Het
Abcb11	T	A	2: 69,265,496	K833N	possibly damaging	Het
Abcb1a	T	A	5: 8,686,171	M188K	probably benign	Het
Akap1	A	T	11: 88,837,140	V672D	probably damaging	Het
Anapc4	A	G	5: 52,864,525	T650A	possibly damaging	Het
Ash1l	C	A	3: 88,982,990	S725R	possibly damaging	Het
Axdnd1	T	A	1: 156,420,347	K28*	probably null	Het
C8b	C	A	4: 104,786,995	H286Q	probably benign	Het
Cacna2d1	A	G	5: 16,012,398	K34E	probably damaging	Het
Ccdc14	T	A	16: 34,697,358	H154Q	probably damaging	Het
Ccdc184	A	G	15: 98,168,512	D66G	probably damaging	Het
Ccdc62	A	G	5: 123,954,709	I586V	possibly damaging	Het
Chadl	A	T	15: 81,694,490	C313S	probably damaging	Het
Clec14a	C	A	12: 58,268,750	A29S	probably damaging	Het
Col26a1	C	T	5: 136,757,754	G161D	probably benign	Het
Ctbp2	A	G	7: 133,014,232	S325P	probably damaging	Het
Dcaf13	A	G	15: 39,130,292	D260G	possibly damaging	Het
Dhx37	G	A	5: 125,422,672	P575L	probably benign	Het
Dnajc6	T	C	4: 101,550,857		probably null	Het
Eapp	T	C	12: 54,690,276	T145A	unknown	Het
Efcab5	A	G	11: 77,121,238	M730T	probably benign	Het
Eif4g3	T	A	4: 138,190,657	D1305E	probably damaging	Het
Endou	A	T	15: 97,712,065	V450E	probably benign	Het
F10	A	T	8: 13,048,177	K127*	probably null	Het
Fbxw21	A	G	9: 109,143,762	F368S	probably damaging	Het
Fezf1	A	T	6: 23,245,798	L456Q	possibly damaging	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Fyco1	A	C	9: 123,794,813	C1384G	probably damaging	Het
Galnt6	G	T	15: 100,704,151	S258R	possibly damaging	Het
Gemin5	A	G	11: 58,137,748	V882A	probably benign	Het
Gm10750	A	G	2: 149,016,187	L48P	unknown	Het
Gm11639	A	G	11: 104,831,300	I1913V	probably benign	Het
Gm16503	T	A	4: 147,541,114	F22I	unknown	Het
Hdac10	A	G	15: 89,126,277	C281R	probably damaging	Het
Hikeshi	T	C	7: 89,935,760	S79G	probably damaging	Het
Ifitm2	AG	A	7: 140,955,901		probably null	Het
Itpr3	A	G	17: 27,111,217	E1603G	probably damaging	Het
Lrrc37a	A	T	11: 103,504,533	V22E	probably benign	Het
Man1a	C	T	10: 53,933,491		probably null	Het
Mdga1	A	G	17: 29,839,897	L5P	probably damaging	Het
Mettl7a1	A	G	15: 100,313,133	E213G	probably damaging	Het
Mup6	A	G	4: 60,004,838	I76M	probably benign	Het
Nbea	A	T	3: 56,091,092	M98K	probably benign	Het
Nckap1l	A	G	15: 103,473,539	E454G	probably damaging	Het
Notch3	A	T	17: 32,143,691	L1320Q	probably benign	Het
Numa1	T	C	7: 101,995,416	S200P	possibly damaging	Het
Numa1	A	G	7: 102,012,796	D1898G	probably damaging	Het
Olfr1124	G	A	2: 87,434,666	A60T	probably benign	Het
Olfr152	A	C	2: 87,782,523		probably null	Het
Olfr366	T	C	2: 37,220,110	I207T	possibly damaging	Het
Olfr700	A	T	7: 106,806,398	S21R	possibly damaging	Het
P2ry6	A	T	7: 100,938,926	Y75*	probably null	Het
Pbrm1	T	A	14: 31,084,803	C1062*	probably null	Het
Pcdh15	A	G	10: 74,643,728	E557G	unknown	Het
Pcdh7	T	C	5: 57,721,335	L744P	probably benign	Het
Plekhg3	A	T	12: 76,562,278	I142L	possibly damaging	Het
Plk4	C	T	3: 40,811,891	H695Y	probably damaging	Het
Pms1	T	C	1: 53,208,057	H243R	probably benign	Het
Prdm14	T	C	1: 13,122,483	D344G	possibly damaging	Het
R3hdml	A	G	2: 163,502,332	I214V	probably benign	Het
Rab11fip5	T	C	6: 85,348,710	N238S	probably benign	Het
Sacs	T	A	14: 61,240,319	Y732N	possibly damaging	Het
Scfd1	T	A	12: 51,393,866	M187K	possibly damaging	Het
Serpina1d	A	G	12: 103,767,998	C16R	probably damaging	Het
Slc2a12	T	C	10: 22,665,095	I283T	possibly damaging	Het
Smarca5	A	G	8: 80,719,803	Y423H	probably damaging	Het
Srrm3	C	A	5: 135,868,261	A366E	unknown	Het
St7	A	T	6: 17,844,914	K134*	probably null	Het
St8sia5	T	G	18: 77,254,829	C412G	probably damaging	Het
Tanc2	A	T	11: 105,886,458	I821F	probably damaging	Het
Tbrg4	A	G	11: 6,624,204	M6T	probably benign	Het
Tcf20	A	T	15: 82,852,696	I1518N	probably benign	Het
Tctn3	A	G	19: 40,607,276	V355A	probably benign	Het
Tenm2	A	T	11: 36,024,500	F2070Y	probably damaging	Het
Tex2	A	G	11: 106,568,535	V23A	probably damaging	Het
Thrsp	C	G	7: 97,417,074	E144Q	probably damaging	Het
Top2a	A	C	11: 99,001,078	S1114A	probably benign	Het
Tpm1	A	G	9: 67,029,716	Y267H	probably benign	Het
Txndc2	G	T	17: 65,639,024	P53T	unknown	Het
Ugt2b36	A	T	5: 87,081,017	I389N	probably damaging	Het
Virma	C	T	4: 11,513,507	R454*	probably null	Het
Vwa3b	T	A	1: 37,035,801	H16Q	probably damaging	Het
Zbp1	A	G	2: 173,210,643	M240T	possibly damaging	Het

Other mutations in Nrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Nrn1	APN	13	36730216	missense	probably damaging	1.00
IGL02801:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02816:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02838:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02859:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02881:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02900:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02927:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02938:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02942:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL03144:Nrn1	APN	13	36730106	critical splice donor site	probably null
IGL02802:Nrn1	UTSW	13	36730106	critical splice donor site	probably null
R0172:Nrn1	UTSW	13	36730570	missense	probably benign
R2126:Nrn1	UTSW	13	36730206	missense	probably damaging	1.00
R5986:Nrn1	UTSW	13	36734264	nonsense	probably null
R7226:Nrn1	UTSW	13	36730603	missense	probably benign	0.03
R7426:Nrn1	UTSW	13	36726851	missense	probably damaging	1.00
R8224:Nrn1	UTSW	13	36734284	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCACAATCCCATATGAGTGTTTTC -3'
(R):5'- ACCCAAAGTGATGCTACTCC -3'

Sequencing Primer
(F):5'- CCCATATGAGTGTTTTCAACATCAC -3'
(R):5'- ACCCAAAGTGATGCTACTCCTTCTG -3'

Posted On

2022-03-25