Incidental Mutation 'R9294:Nrn1'
ID 704491
Institutional Source Beutler Lab
Gene Symbol Nrn1
Ensembl Gene ENSMUSG00000039114
Gene Name neuritin 1
Synonyms cpg15, 0710008J23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 36725361-36735131 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36726674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 128 (L128H)
Ref Sequence ENSEMBL: ENSMUSP00000040900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037623] [ENSMUST00000122286] [ENSMUST00000223611] [ENSMUST00000224323] [ENSMUST00000224916] [ENSMUST00000224960]
AlphaFold Q8CFV4
Predicted Effect probably damaging
Transcript: ENSMUST00000037623
AA Change: L128H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040900
Gene: ENSMUSG00000039114
AA Change: L128H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:NRN1 31 120 1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122286
AA Change: L144H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113721
Gene: ENSMUSG00000039114
AA Change: L144H

DomainStartEndE-ValueType
Pfam:NRN1 47 133 2.7e-42 PFAM
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223611
AA Change: L80H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000224323
AA Change: L137H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000224916
Predicted Effect probably damaging
Transcript: ENSMUST00000224960
AA Change: L128H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body length and body weight, delayed axonal, dendritic, and synaptic development, reduced dendritic spine maintenance leading to gradual spine loss, and impaired associative and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Nrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nrn1 APN 13 36730216 missense probably damaging 1.00
IGL02801:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02816:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02838:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02859:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02881:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02900:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02927:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02938:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02942:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL03144:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02802:Nrn1 UTSW 13 36730106 critical splice donor site probably null
R0172:Nrn1 UTSW 13 36730570 missense probably benign
R2126:Nrn1 UTSW 13 36730206 missense probably damaging 1.00
R5986:Nrn1 UTSW 13 36734264 nonsense probably null
R7226:Nrn1 UTSW 13 36730603 missense probably benign 0.03
R7426:Nrn1 UTSW 13 36726851 missense probably damaging 1.00
R8224:Nrn1 UTSW 13 36734284 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACAATCCCATATGAGTGTTTTC -3'
(R):5'- ACCCAAAGTGATGCTACTCC -3'

Sequencing Primer
(F):5'- CCCATATGAGTGTTTTCAACATCAC -3'
(R):5'- ACCCAAAGTGATGCTACTCCTTCTG -3'
Posted On 2022-03-25