Incidental Mutation 'R9294:Cfap20dc'
ID 704492
Institutional Source Beutler Lab
Gene Symbol Cfap20dc
Ensembl Gene ENSMUSG00000021747
Gene Name CFAP20 domain containing
Synonyms 4930452B06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 13803533-14038581 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8578361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 127 (I127T)
Ref Sequence ENSEMBL: ENSMUSP00000100061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102996]
AlphaFold Q6P2K3
Predicted Effect possibly damaging
Transcript: ENSMUST00000102996
AA Change: I127T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100061
Gene: ENSMUSG00000021747
AA Change: I127T

DomainStartEndE-ValueType
Pfam:DUF667 1 188 1.7e-43 PFAM
low complexity region 344 358 N/A INTRINSIC
low complexity region 506 519 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik A G 8: 84,730,008 (GRCm39) Y165C probably damaging Het
Abcb11 T A 2: 69,095,840 (GRCm39) K833N possibly damaging Het
Abcb1a T A 5: 8,736,171 (GRCm39) M188K probably benign Het
Akap1 A T 11: 88,727,966 (GRCm39) V672D probably damaging Het
Anapc4 A G 5: 53,021,867 (GRCm39) T650A possibly damaging Het
Ash1l C A 3: 88,890,297 (GRCm39) S725R possibly damaging Het
Axdnd1 T A 1: 156,247,917 (GRCm39) K28* probably null Het
C8b C A 4: 104,644,192 (GRCm39) H286Q probably benign Het
Cacna2d1 A G 5: 16,217,396 (GRCm39) K34E probably damaging Het
Ccdc14 T A 16: 34,517,728 (GRCm39) H154Q probably damaging Het
Ccdc184 A G 15: 98,066,393 (GRCm39) D66G probably damaging Het
Ccdc62 A G 5: 124,092,772 (GRCm39) I586V possibly damaging Het
Chadl A T 15: 81,578,691 (GRCm39) C313S probably damaging Het
Clec14a C A 12: 58,315,536 (GRCm39) A29S probably damaging Het
Col26a1 C T 5: 136,786,608 (GRCm39) G161D probably benign Het
Cplane1 T C 15: 8,232,811 (GRCm39) V1110A probably benign Het
Ctbp2 A G 7: 132,615,961 (GRCm39) S325P probably damaging Het
Dcaf13 A G 15: 38,993,687 (GRCm39) D260G possibly damaging Het
Dele1 T G 18: 38,394,129 (GRCm39) L442R probably damaging Het
Dhx37 G A 5: 125,499,736 (GRCm39) P575L probably benign Het
Dnajc6 T C 4: 101,408,054 (GRCm39) probably null Het
Eapp T C 12: 54,737,061 (GRCm39) T145A unknown Het
Efcab3 A G 11: 104,722,126 (GRCm39) I1913V probably benign Het
Efcab5 A G 11: 77,012,064 (GRCm39) M730T probably benign Het
Eif4g3 T A 4: 137,917,968 (GRCm39) D1305E probably damaging Het
Endou A T 15: 97,609,946 (GRCm39) V450E probably benign Het
F10 A T 8: 13,098,177 (GRCm39) K127* probably null Het
Fbxw21 A G 9: 108,972,830 (GRCm39) F368S probably damaging Het
Fezf1 A T 6: 23,245,797 (GRCm39) L456Q possibly damaging Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Fyco1 A C 9: 123,623,878 (GRCm39) C1384G probably damaging Het
Galnt6 G T 15: 100,602,032 (GRCm39) S258R possibly damaging Het
Gemin5 A G 11: 58,028,574 (GRCm39) V882A probably benign Het
Gm10750 A G 2: 148,858,107 (GRCm39) L48P unknown Het
Gm16503 T A 4: 147,625,571 (GRCm39) F22I unknown Het
Hdac10 A G 15: 89,010,480 (GRCm39) C281R probably damaging Het
Hikeshi T C 7: 89,584,968 (GRCm39) S79G probably damaging Het
Ifitm2 AG A 7: 140,535,814 (GRCm39) probably null Het
Itpr3 A G 17: 27,330,191 (GRCm39) E1603G probably damaging Het
Lrrc37a A T 11: 103,395,359 (GRCm39) V22E probably benign Het
Man1a C T 10: 53,809,587 (GRCm39) probably null Het
Mdga1 A G 17: 30,058,871 (GRCm39) L5P probably damaging Het
Mup6 A G 4: 60,004,838 (GRCm39) I76M probably benign Het
Nbea A T 3: 55,998,513 (GRCm39) M98K probably benign Het
Nckap1l A G 15: 103,381,966 (GRCm39) E454G probably damaging Het
Notch3 A T 17: 32,362,665 (GRCm39) L1320Q probably benign Het
Nrn1 A T 13: 36,910,648 (GRCm39) L128H probably damaging Het
Numa1 T C 7: 101,644,623 (GRCm39) S200P possibly damaging Het
Numa1 A G 7: 101,662,003 (GRCm39) D1898G probably damaging Het
Or10ag58 G A 2: 87,265,010 (GRCm39) A60T probably benign Het
Or1af1 T C 2: 37,110,122 (GRCm39) I207T possibly damaging Het
Or2ag18 A T 7: 106,405,605 (GRCm39) S21R possibly damaging Het
Or5i1 A C 2: 87,612,867 (GRCm39) probably null Het
P2ry6 A T 7: 100,588,133 (GRCm39) Y75* probably null Het
Pbrm1 T A 14: 30,806,760 (GRCm39) C1062* probably null Het
Pcdh15 A G 10: 74,479,560 (GRCm39) E557G unknown Het
Pcdh7 T C 5: 57,878,677 (GRCm39) L744P probably benign Het
Plekhg3 A T 12: 76,609,052 (GRCm39) I142L possibly damaging Het
Plk4 C T 3: 40,766,326 (GRCm39) H695Y probably damaging Het
Pms1 T C 1: 53,247,216 (GRCm39) H243R probably benign Het
Prdm14 T C 1: 13,192,707 (GRCm39) D344G possibly damaging Het
R3hdml A G 2: 163,344,252 (GRCm39) I214V probably benign Het
Rab11fip5 T C 6: 85,325,692 (GRCm39) N238S probably benign Het
Resf1 T A 6: 149,227,930 (GRCm39) N325K probably benign Het
Sacs T A 14: 61,477,768 (GRCm39) Y732N possibly damaging Het
Scfd1 T A 12: 51,440,649 (GRCm39) M187K possibly damaging Het
Serpina1d A G 12: 103,734,257 (GRCm39) C16R probably damaging Het
Slc2a12 T C 10: 22,540,994 (GRCm39) I283T possibly damaging Het
Smarca5 A G 8: 81,446,432 (GRCm39) Y423H probably damaging Het
Srrm3 C A 5: 135,897,115 (GRCm39) A366E unknown Het
St7 A T 6: 17,844,913 (GRCm39) K134* probably null Het
St8sia5 T G 18: 77,342,525 (GRCm39) C412G probably damaging Het
Tanc2 A T 11: 105,777,284 (GRCm39) I821F probably damaging Het
Tbrg4 A G 11: 6,574,204 (GRCm39) M6T probably benign Het
Tcf20 A T 15: 82,736,897 (GRCm39) I1518N probably benign Het
Tctn3 A G 19: 40,595,720 (GRCm39) V355A probably benign Het
Tenm2 A T 11: 35,915,327 (GRCm39) F2070Y probably damaging Het
Tex2 A G 11: 106,459,361 (GRCm39) V23A probably damaging Het
Thrsp C G 7: 97,066,281 (GRCm39) E144Q probably damaging Het
Tmt1a A G 15: 100,211,014 (GRCm39) E213G probably damaging Het
Top2a A C 11: 98,891,904 (GRCm39) S1114A probably benign Het
Tpm1 A G 9: 66,936,998 (GRCm39) Y267H probably benign Het
Txndc2 G T 17: 65,946,019 (GRCm39) P53T unknown Het
Ugt2b36 A T 5: 87,228,876 (GRCm39) I389N probably damaging Het
Virma C T 4: 11,513,507 (GRCm39) R454* probably null Het
Vwa3b T A 1: 37,074,882 (GRCm39) H16Q probably damaging Het
Zbp1 A G 2: 173,052,436 (GRCm39) M240T possibly damaging Het
Other mutations in Cfap20dc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cfap20dc APN 14 8,473,370 (GRCm38) missense possibly damaging 0.57
IGL02010:Cfap20dc APN 14 8,578,384 (GRCm38) missense possibly damaging 0.68
IGL02385:Cfap20dc APN 14 8,510,920 (GRCm38) missense possibly damaging 0.59
IGL02431:Cfap20dc APN 14 8,659,424 (GRCm38) missense probably damaging 1.00
IGL02723:Cfap20dc APN 14 8,516,507 (GRCm38) missense probably benign 0.02
IGL02865:Cfap20dc APN 14 8,517,940 (GRCm38) missense probably benign 0.00
IGL03030:Cfap20dc APN 14 8,511,113 (GRCm38) missense probably damaging 1.00
IGL03204:Cfap20dc APN 14 8,644,436 (GRCm38) missense possibly damaging 0.68
IGL03014:Cfap20dc UTSW 14 8,431,608 (GRCm38) makesense probably null
R0197:Cfap20dc UTSW 14 8,518,695 (GRCm38) missense probably damaging 1.00
R0265:Cfap20dc UTSW 14 8,431,667 (GRCm38) missense probably damaging 1.00
R0513:Cfap20dc UTSW 14 8,536,609 (GRCm38) missense probably damaging 1.00
R0647:Cfap20dc UTSW 14 8,536,655 (GRCm38) missense possibly damaging 0.94
R1168:Cfap20dc UTSW 14 8,442,939 (GRCm38) missense probably benign 0.22
R1610:Cfap20dc UTSW 14 8,511,110 (GRCm38) missense probably benign 0.00
R1625:Cfap20dc UTSW 14 8,431,668 (GRCm38) missense probably damaging 1.00
R2010:Cfap20dc UTSW 14 8,511,021 (GRCm38) missense probably damaging 1.00
R2084:Cfap20dc UTSW 14 8,558,171 (GRCm38) missense probably damaging 1.00
R2174:Cfap20dc UTSW 14 8,558,109 (GRCm38) missense probably benign 0.02
R3802:Cfap20dc UTSW 14 8,510,931 (GRCm38) missense probably benign 0.00
R4244:Cfap20dc UTSW 14 8,482,521 (GRCm38) missense probably benign 0.00
R4471:Cfap20dc UTSW 14 8,536,571 (GRCm38) missense probably damaging 1.00
R4516:Cfap20dc UTSW 14 8,536,609 (GRCm38) missense probably damaging 1.00
R4824:Cfap20dc UTSW 14 8,665,997 (GRCm38) start codon destroyed probably null 0.93
R4884:Cfap20dc UTSW 14 8,578,394 (GRCm38) missense probably damaging 0.97
R4975:Cfap20dc UTSW 14 8,518,736 (GRCm38) missense probably benign 0.00
R5455:Cfap20dc UTSW 14 8,536,516 (GRCm38) critical splice donor site probably null
R6280:Cfap20dc UTSW 14 8,473,414 (GRCm38) critical splice acceptor site probably null
R6438:Cfap20dc UTSW 14 8,431,701 (GRCm38) missense probably damaging 0.98
R6639:Cfap20dc UTSW 14 8,536,530 (GRCm38) missense probably benign 0.12
R7101:Cfap20dc UTSW 14 8,511,171 (GRCm38) missense possibly damaging 0.75
R7456:Cfap20dc UTSW 14 8,442,933 (GRCm38) nonsense probably null
R8266:Cfap20dc UTSW 14 8,482,599 (GRCm38) nonsense probably null
R8854:Cfap20dc UTSW 14 8,518,638 (GRCm38) missense probably damaging 1.00
R9053:Cfap20dc UTSW 14 8,518,768 (GRCm38) critical splice acceptor site probably null
R9157:Cfap20dc UTSW 14 8,518,635 (GRCm38) missense probably benign 0.00
R9313:Cfap20dc UTSW 14 8,518,635 (GRCm38) missense probably benign 0.00
R9502:Cfap20dc UTSW 14 8,659,452 (GRCm38) missense probably damaging 0.98
Z1177:Cfap20dc UTSW 14 8,517,953 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTAGGGGATGTCAAGGAGC -3'
(R):5'- GTTCTGTGTTCGAACTCCATGTTAG -3'

Sequencing Primer
(F):5'- CTAGGGGATGTCAAGGAGCAAGAAG -3'
(R):5'- GTTCGAACTCCATGTTAGAAAAAGCC -3'
Posted On 2022-03-25