Incidental Mutation 'R9294:Hdac10'
ID 704499
Institutional Source Beutler Lab
Gene Symbol Hdac10
Ensembl Gene ENSMUSG00000062906
Gene Name histone deacetylase 10
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 89123307-89128700 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89126277 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 281 (C281R)
Ref Sequence ENSEMBL: ENSMUSP00000080832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000088827] [ENSMUST00000109347] [ENSMUST00000109353]
AlphaFold Q6P3E7
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082197
AA Change: C281R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906
AA Change: C281R

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Hdac10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Hdac10 APN 15 89128442 missense probably damaging 1.00
IGL01063:Hdac10 APN 15 89123868 missense possibly damaging 0.68
IGL01577:Hdac10 APN 15 89126213 missense possibly damaging 0.90
IGL01690:Hdac10 APN 15 89125991 missense probably benign 0.00
IGL01724:Hdac10 APN 15 89124709 unclassified probably benign
IGL01866:Hdac10 APN 15 89124533 missense probably damaging 1.00
IGL01989:Hdac10 APN 15 89125343 missense probably damaging 1.00
IGL01995:Hdac10 APN 15 89127598 missense probably damaging 1.00
IGL02256:Hdac10 APN 15 89125894 unclassified probably benign
IGL02668:Hdac10 APN 15 89125644 missense probably benign 0.10
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0454:Hdac10 UTSW 15 89125758 splice site probably null
R0723:Hdac10 UTSW 15 89126418 missense probably damaging 1.00
R0924:Hdac10 UTSW 15 89125862 missense probably benign
R1553:Hdac10 UTSW 15 89125515 missense possibly damaging 0.51
R1608:Hdac10 UTSW 15 89125318 missense probably benign 0.04
R1619:Hdac10 UTSW 15 89126675 missense probably damaging 1.00
R1715:Hdac10 UTSW 15 89126709 splice site probably null
R2284:Hdac10 UTSW 15 89127404 missense probably benign 0.00
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R3688:Hdac10 UTSW 15 89123564 critical splice donor site probably null
R4283:Hdac10 UTSW 15 89125623 missense possibly damaging 0.94
R4604:Hdac10 UTSW 15 89125397 critical splice acceptor site probably null
R4654:Hdac10 UTSW 15 89126833 unclassified probably benign
R4898:Hdac10 UTSW 15 89128447 start codon destroyed probably null 1.00
R4998:Hdac10 UTSW 15 89123940 missense possibly damaging 0.94
R5393:Hdac10 UTSW 15 89126684 missense probably damaging 1.00
R5769:Hdac10 UTSW 15 89123616 missense probably benign 0.00
R5785:Hdac10 UTSW 15 89126945 missense probably benign
R6992:Hdac10 UTSW 15 89125331 missense probably benign 0.01
R7149:Hdac10 UTSW 15 89127449 missense probably damaging 1.00
R7237:Hdac10 UTSW 15 89125377 missense probably benign
R7276:Hdac10 UTSW 15 89128285 missense probably benign 0.01
R7395:Hdac10 UTSW 15 89128284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCTAGGGACTCCAAGTGGTAG -3'
(R):5'- CACCGGATCCTGCCTATAGTTTG -3'

Sequencing Primer
(F):5'- TGGTAGCCACCCTAGGAAG -3'
(R):5'- GATCCTGCCTATAGTTTGATCCTGAG -3'
Posted On 2022-03-25