Incidental Mutation 'R9294:Itpr3'
ID 704506
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9294 (G1)
Quality Score 214.009
Status Not validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27111217 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1603 (E1603G)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049308
AA Change: E1603G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: E1603G

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Meta Mutation Damage Score 0.5570 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mdga1 A G 17: 29,839,897 L5P probably damaging Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27118677 unclassified probably benign
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27118677 unclassified probably benign
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9477:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATCATTGAGAAGTTACAGGTGG -3'
(R):5'- TCTCTGACACCAGGTTACCC -3'

Sequencing Primer
(F):5'- AAGTTACAGGTGGGCGTG -3'
(R):5'- AGGTTACCCTGCCCAGAC -3'
Posted On 2022-03-25