Incidental Mutation 'R9294:Mdga1'
ID 704507
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 29827956-29970087 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29839897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 5 (L5P)
Ref Sequence ENSEMBL: ENSMUSP00000126571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]
AlphaFold Q0PMG2
Predicted Effect probably damaging
Transcript: ENSMUST00000073556
AA Change: L712P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: L712P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167190
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168044
AA Change: L5P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557
AA Change: L5P

DomainStartEndE-ValueType
Pfam:MAM 47 186 3.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171691
AA Change: L712P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: L712P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T G 18: 38,261,076 L442R probably damaging Het
1700067K01Rik A G 8: 84,003,379 Y165C probably damaging Het
2410089E03Rik T C 15: 8,203,327 V1110A probably benign Het
2810474O19Rik T A 6: 149,326,432 N325K probably benign Het
4930452B06Rik A G 14: 8,578,361 I127T possibly damaging Het
Abcb11 T A 2: 69,265,496 K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 M188K probably benign Het
Akap1 A T 11: 88,837,140 V672D probably damaging Het
Anapc4 A G 5: 52,864,525 T650A possibly damaging Het
Ash1l C A 3: 88,982,990 S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 K28* probably null Het
C8b C A 4: 104,786,995 H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 I586V possibly damaging Het
Chadl A T 15: 81,694,490 C313S probably damaging Het
Clec14a C A 12: 58,268,750 A29S probably damaging Het
Col26a1 C T 5: 136,757,754 G161D probably benign Het
Ctbp2 A G 7: 133,014,232 S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 D260G possibly damaging Het
Dhx37 G A 5: 125,422,672 P575L probably benign Het
Dnajc6 T C 4: 101,550,857 probably null Het
Eapp T C 12: 54,690,276 T145A unknown Het
Efcab5 A G 11: 77,121,238 M730T probably benign Het
Eif4g3 T A 4: 138,190,657 D1305E probably damaging Het
Endou A T 15: 97,712,065 V450E probably benign Het
F10 A T 8: 13,048,177 K127* probably null Het
Fbxw21 A G 9: 109,143,762 F368S probably damaging Het
Fezf1 A T 6: 23,245,798 L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Fyco1 A C 9: 123,794,813 C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 V882A probably benign Het
Gm10750 A G 2: 149,016,187 L48P unknown Het
Gm11639 A G 11: 104,831,300 I1913V probably benign Het
Gm16503 T A 4: 147,541,114 F22I unknown Het
Hdac10 A G 15: 89,126,277 C281R probably damaging Het
Hikeshi T C 7: 89,935,760 S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 V22E probably benign Het
Man1a C T 10: 53,933,491 probably null Het
Mettl7a1 A G 15: 100,313,133 E213G probably damaging Het
Mup6 A G 4: 60,004,838 I76M probably benign Het
Nbea A T 3: 56,091,092 M98K probably benign Het
Nckap1l A G 15: 103,473,539 E454G probably damaging Het
Notch3 A T 17: 32,143,691 L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 L128H probably damaging Het
Numa1 T C 7: 101,995,416 S200P possibly damaging Het
Numa1 A G 7: 102,012,796 D1898G probably damaging Het
Olfr1124 G A 2: 87,434,666 A60T probably benign Het
Olfr152 A C 2: 87,782,523 probably null Het
Olfr366 T C 2: 37,220,110 I207T possibly damaging Het
Olfr700 A T 7: 106,806,398 S21R possibly damaging Het
P2ry6 A T 7: 100,938,926 Y75* probably null Het
Pbrm1 T A 14: 31,084,803 C1062* probably null Het
Pcdh15 A G 10: 74,643,728 E557G unknown Het
Pcdh7 T C 5: 57,721,335 L744P probably benign Het
Plekhg3 A T 12: 76,562,278 I142L possibly damaging Het
Plk4 C T 3: 40,811,891 H695Y probably damaging Het
Pms1 T C 1: 53,208,057 H243R probably benign Het
Prdm14 T C 1: 13,122,483 D344G possibly damaging Het
R3hdml A G 2: 163,502,332 I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 N238S probably benign Het
Sacs T A 14: 61,240,319 Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 A366E unknown Het
St7 A T 6: 17,844,914 K134* probably null Het
St8sia5 T G 18: 77,254,829 C412G probably damaging Het
Tanc2 A T 11: 105,886,458 I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 M6T probably benign Het
Tcf20 A T 15: 82,852,696 I1518N probably benign Het
Tctn3 A G 19: 40,607,276 V355A probably benign Het
Tenm2 A T 11: 36,024,500 F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 V23A probably damaging Het
Thrsp C G 7: 97,417,074 E144Q probably damaging Het
Top2a A C 11: 99,001,078 S1114A probably benign Het
Tpm1 A G 9: 67,029,716 Y267H probably benign Het
Txndc2 G T 17: 65,639,024 P53T unknown Het
Ugt2b36 A T 5: 87,081,017 I389N probably damaging Het
Virma C T 4: 11,513,507 R454* probably null Het
Vwa3b T A 1: 37,035,801 H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 M240T possibly damaging Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 29843127 missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 29839871 missense probably damaging 1.00
IGL02130:Mdga1 APN 17 29857669 missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 29832405 splice site probably benign
IGL03258:Mdga1 APN 17 29839913 missense probably damaging 1.00
R0184:Mdga1 UTSW 17 29852442 missense probably damaging 1.00
R0366:Mdga1 UTSW 17 29857708 missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 29850548 missense probably damaging 0.98
R1520:Mdga1 UTSW 17 29846519 missense probably benign 0.12
R1545:Mdga1 UTSW 17 29842902 missense probably damaging 1.00
R1549:Mdga1 UTSW 17 29837998 missense probably damaging 1.00
R1671:Mdga1 UTSW 17 29850629 missense probably damaging 1.00
R1875:Mdga1 UTSW 17 29852607 missense probably damaging 1.00
R1893:Mdga1 UTSW 17 29849226 missense probably damaging 1.00
R1958:Mdga1 UTSW 17 29840888 missense probably damaging 1.00
R1983:Mdga1 UTSW 17 29850605 missense probably damaging 1.00
R2014:Mdga1 UTSW 17 29849313 missense probably damaging 1.00
R2894:Mdga1 UTSW 17 29852504 missense probably damaging 1.00
R2964:Mdga1 UTSW 17 29852468 missense probably damaging 1.00
R3813:Mdga1 UTSW 17 29838479 missense probably damaging 1.00
R3938:Mdga1 UTSW 17 29857622 missense probably damaging 1.00
R3982:Mdga1 UTSW 17 29931264 missense unknown
R4063:Mdga1 UTSW 17 29838031 missense probably damaging 1.00
R4157:Mdga1 UTSW 17 29833343 missense probably benign 0.32
R4183:Mdga1 UTSW 17 29969990 missense unknown
R4392:Mdga1 UTSW 17 29850656 missense probably damaging 1.00
R4393:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4396:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4806:Mdga1 UTSW 17 29842154 missense probably benign 0.20
R4829:Mdga1 UTSW 17 29846369 missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 29838078 missense probably damaging 0.99
R4932:Mdga1 UTSW 17 29857606 missense probably damaging 1.00
R5015:Mdga1 UTSW 17 29839873 missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 29850554 missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 29852493 missense probably benign 0.43
R5180:Mdga1 UTSW 17 29857736 splice site probably benign
R5590:Mdga1 UTSW 17 29839867 missense probably damaging 1.00
R5747:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R5748:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R6207:Mdga1 UTSW 17 29838517 missense probably damaging 1.00
R6826:Mdga1 UTSW 17 29970026 missense unknown
R6831:Mdga1 UTSW 17 29887516 nonsense probably null
R7114:Mdga1 UTSW 17 29842842 splice site probably null
R7147:Mdga1 UTSW 17 29846521 nonsense probably null
R7273:Mdga1 UTSW 17 29969938 missense unknown
R7413:Mdga1 UTSW 17 29850673 missense probably damaging 1.00
R7637:Mdga1 UTSW 17 29832379 missense probably benign 0.00
R7797:Mdga1 UTSW 17 29842840 splice site probably null
R7812:Mdga1 UTSW 17 29843141 missense probably benign 0.02
R7838:Mdga1 UTSW 17 29839822 missense probably benign 0.10
R8463:Mdga1 UTSW 17 29849729 missense probably damaging 1.00
R8697:Mdga1 UTSW 17 29846641 missense probably damaging 0.97
R8699:Mdga1 UTSW 17 29842374 missense possibly damaging 0.87
R8864:Mdga1 UTSW 17 29931321 missense unknown
R8945:Mdga1 UTSW 17 29839985 splice site probably benign
R9150:Mdga1 UTSW 17 29838446 missense probably damaging 0.98
R9157:Mdga1 UTSW 17 29838517 missense probably damaging 1.00
R9301:Mdga1 UTSW 17 29850538 missense probably benign 0.31
R9367:Mdga1 UTSW 17 29832308 makesense probably null
R9567:Mdga1 UTSW 17 29857595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAAGAGTGCCCAGGCTG -3'
(R):5'- ACTCTCCTGAAGCATTCCAGGG -3'

Sequencing Primer
(F):5'- GATCTTTGGGGCCAGGAC -3'
(R):5'- ACAATGCCATGGTCAAGG -3'
Posted On 2022-03-25