Incidental Mutation 'R9294:Txndc2'
ID 704509
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Name thioredoxin domain containing 2 (spermatozoa)
Synonyms Sptrx-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9294 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 65637505-65642204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 65639024 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 53 (P53T)
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000050236
AA Change: P53T
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612
AA Change: P53T

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik A G 8: 84,003,379 (GRCm38) Y165C probably damaging Het
Abcb11 T A 2: 69,265,496 (GRCm38) K833N possibly damaging Het
Abcb1a T A 5: 8,686,171 (GRCm38) M188K probably benign Het
Akap1 A T 11: 88,837,140 (GRCm38) V672D probably damaging Het
Anapc4 A G 5: 52,864,525 (GRCm38) T650A possibly damaging Het
Ash1l C A 3: 88,982,990 (GRCm38) S725R possibly damaging Het
Axdnd1 T A 1: 156,420,347 (GRCm38) K28* probably null Het
C8b C A 4: 104,786,995 (GRCm38) H286Q probably benign Het
Cacna2d1 A G 5: 16,012,398 (GRCm38) K34E probably damaging Het
Ccdc14 T A 16: 34,697,358 (GRCm38) H154Q probably damaging Het
Ccdc184 A G 15: 98,168,512 (GRCm38) D66G probably damaging Het
Ccdc62 A G 5: 123,954,709 (GRCm38) I586V possibly damaging Het
Cfap20dc A G 14: 8,578,361 (GRCm38) I127T possibly damaging Het
Chadl A T 15: 81,694,490 (GRCm38) C313S probably damaging Het
Clec14a C A 12: 58,268,750 (GRCm38) A29S probably damaging Het
Col26a1 C T 5: 136,757,754 (GRCm38) G161D probably benign Het
Cplane1 T C 15: 8,203,327 (GRCm38) V1110A probably benign Het
Ctbp2 A G 7: 133,014,232 (GRCm38) S325P probably damaging Het
Dcaf13 A G 15: 39,130,292 (GRCm38) D260G possibly damaging Het
Dele1 T G 18: 38,261,076 (GRCm38) L442R probably damaging Het
Dhx37 G A 5: 125,422,672 (GRCm38) P575L probably benign Het
Dnajc6 T C 4: 101,550,857 (GRCm38) probably null Het
Eapp T C 12: 54,690,276 (GRCm38) T145A unknown Het
Efcab5 A G 11: 77,121,238 (GRCm38) M730T probably benign Het
Eif4g3 T A 4: 138,190,657 (GRCm38) D1305E probably damaging Het
Endou A T 15: 97,712,065 (GRCm38) V450E probably benign Het
F10 A T 8: 13,048,177 (GRCm38) K127* probably null Het
Fbxw21 A G 9: 109,143,762 (GRCm38) F368S probably damaging Het
Fezf1 A T 6: 23,245,798 (GRCm38) L456Q possibly damaging Het
Foxo3 C T 10: 42,197,025 (GRCm38) V499M probably damaging Het
Fyco1 A C 9: 123,794,813 (GRCm38) C1384G probably damaging Het
Galnt6 G T 15: 100,704,151 (GRCm38) S258R possibly damaging Het
Gemin5 A G 11: 58,137,748 (GRCm38) V882A probably benign Het
Gm10750 A G 2: 149,016,187 (GRCm38) L48P unknown Het
Gm11639 A G 11: 104,831,300 (GRCm38) I1913V probably benign Het
Gm16503 T A 4: 147,541,114 (GRCm38) F22I unknown Het
Hdac10 A G 15: 89,126,277 (GRCm38) C281R probably damaging Het
Hikeshi T C 7: 89,935,760 (GRCm38) S79G probably damaging Het
Ifitm2 AG A 7: 140,955,901 (GRCm38) probably null Het
Itpr3 A G 17: 27,111,217 (GRCm38) E1603G probably damaging Het
Lrrc37a A T 11: 103,504,533 (GRCm38) V22E probably benign Het
Man1a C T 10: 53,933,491 (GRCm38) probably null Het
Mdga1 A G 17: 29,839,897 (GRCm38) L5P probably damaging Het
Mup6 A G 4: 60,004,838 (GRCm38) I76M probably benign Het
Nbea A T 3: 56,091,092 (GRCm38) M98K probably benign Het
Nckap1l A G 15: 103,473,539 (GRCm38) E454G probably damaging Het
Notch3 A T 17: 32,143,691 (GRCm38) L1320Q probably benign Het
Nrn1 A T 13: 36,726,674 (GRCm38) L128H probably damaging Het
Numa1 A G 7: 102,012,796 (GRCm38) D1898G probably damaging Het
Numa1 T C 7: 101,995,416 (GRCm38) S200P possibly damaging Het
Or10ag58 G A 2: 87,434,666 (GRCm38) A60T probably benign Het
Or1af1 T C 2: 37,220,110 (GRCm38) I207T possibly damaging Het
Or2ag18 A T 7: 106,806,398 (GRCm38) S21R possibly damaging Het
Or5i1 A C 2: 87,782,523 (GRCm38) probably null Het
P2ry6 A T 7: 100,938,926 (GRCm38) Y75* probably null Het
Pbrm1 T A 14: 31,084,803 (GRCm38) C1062* probably null Het
Pcdh15 A G 10: 74,643,728 (GRCm38) E557G unknown Het
Pcdh7 T C 5: 57,721,335 (GRCm38) L744P probably benign Het
Plekhg3 A T 12: 76,562,278 (GRCm38) I142L possibly damaging Het
Plk4 C T 3: 40,811,891 (GRCm38) H695Y probably damaging Het
Pms1 T C 1: 53,208,057 (GRCm38) H243R probably benign Het
Prdm14 T C 1: 13,122,483 (GRCm38) D344G possibly damaging Het
R3hdml A G 2: 163,502,332 (GRCm38) I214V probably benign Het
Rab11fip5 T C 6: 85,348,710 (GRCm38) N238S probably benign Het
Resf1 T A 6: 149,326,432 (GRCm38) N325K probably benign Het
Sacs T A 14: 61,240,319 (GRCm38) Y732N possibly damaging Het
Scfd1 T A 12: 51,393,866 (GRCm38) M187K possibly damaging Het
Serpina1d A G 12: 103,767,998 (GRCm38) C16R probably damaging Het
Slc2a12 T C 10: 22,665,095 (GRCm38) I283T possibly damaging Het
Smarca5 A G 8: 80,719,803 (GRCm38) Y423H probably damaging Het
Srrm3 C A 5: 135,868,261 (GRCm38) A366E unknown Het
St7 A T 6: 17,844,914 (GRCm38) K134* probably null Het
St8sia5 T G 18: 77,254,829 (GRCm38) C412G probably damaging Het
Tanc2 A T 11: 105,886,458 (GRCm38) I821F probably damaging Het
Tbrg4 A G 11: 6,624,204 (GRCm38) M6T probably benign Het
Tcf20 A T 15: 82,852,696 (GRCm38) I1518N probably benign Het
Tctn3 A G 19: 40,607,276 (GRCm38) V355A probably benign Het
Tenm2 A T 11: 36,024,500 (GRCm38) F2070Y probably damaging Het
Tex2 A G 11: 106,568,535 (GRCm38) V23A probably damaging Het
Thrsp C G 7: 97,417,074 (GRCm38) E144Q probably damaging Het
Tmt1a A G 15: 100,313,133 (GRCm38) E213G probably damaging Het
Top2a A C 11: 99,001,078 (GRCm38) S1114A probably benign Het
Tpm1 A G 9: 67,029,716 (GRCm38) Y267H probably benign Het
Ugt2b36 A T 5: 87,081,017 (GRCm38) I389N probably damaging Het
Virma C T 4: 11,513,507 (GRCm38) R454* probably null Het
Vwa3b T A 1: 37,035,801 (GRCm38) H16Q probably damaging Het
Zbp1 A G 2: 173,210,643 (GRCm38) M240T possibly damaging Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65,638,574 (GRCm38) missense probably benign 0.41
IGL00985:Txndc2 APN 17 65,638,549 (GRCm38) missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65,638,453 (GRCm38) missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65,638,913 (GRCm38) missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65,637,976 (GRCm38) missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65,639,590 (GRCm38) missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65,639,606 (GRCm38) missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65,637,953 (GRCm38) missense probably benign 0.01
R0737:Txndc2 UTSW 17 65,639,553 (GRCm38) critical splice donor site probably null
R1525:Txndc2 UTSW 17 65,638,315 (GRCm38) missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65,638,926 (GRCm38) missense probably benign 0.44
R1746:Txndc2 UTSW 17 65,638,135 (GRCm38) missense probably damaging 1.00
R4063:Txndc2 UTSW 17 65,638,084 (GRCm38) missense possibly damaging 0.86
R4971:Txndc2 UTSW 17 65,638,854 (GRCm38) missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65,638,060 (GRCm38) missense probably benign 0.01
R6177:Txndc2 UTSW 17 65,638,471 (GRCm38) missense probably benign 0.44
R6762:Txndc2 UTSW 17 65,638,972 (GRCm38) missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65,638,291 (GRCm38) missense probably benign
R7574:Txndc2 UTSW 17 65,638,625 (GRCm38) missense possibly damaging 0.86
R7775:Txndc2 UTSW 17 65,638,243 (GRCm38) missense probably benign 0.01
R9359:Txndc2 UTSW 17 65,637,997 (GRCm38) missense probably damaging 0.99
R9403:Txndc2 UTSW 17 65,637,997 (GRCm38) missense probably damaging 0.99
R9669:Txndc2 UTSW 17 65,638,588 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTCATGTCTGGGATGGACG -3'
(R):5'- AGATGCCTTCATGGTCTCTCTAAG -3'

Sequencing Primer
(F):5'- CGGTATTCTCTGAAAACATGGG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2022-03-25