Incidental Mutation 'R9295:Ercc5'
ID 704513
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9295 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 44158857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 145 (V145F)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027214
AA Change: V145F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V145F

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,692 V7E probably benign Het
Adam17 A G 12: 21,349,937 V156A probably benign Het
Ankrd6 A T 4: 32,822,160 V236E probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
BC080695 A G 4: 143,572,134 T216A possibly damaging Het
C2cd3 C A 7: 100,432,527 D1125E Het
Cacna2d2 A G 9: 107,509,220 E182G probably benign Het
Cct3 A G 3: 88,305,123 K139E probably benign Het
Cd96 G T 16: 46,117,881 Q74K probably benign Het
Cdk5rap1 A T 2: 154,352,266 I373N probably damaging Het
Cep350 A T 1: 155,862,305 Y2597* probably null Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clcn1 G A 6: 42,313,949 G919E probably benign Het
Col6a4 G A 9: 106,080,535 A30V probably damaging Het
Copa T C 1: 172,112,256 C655R probably damaging Het
Cpt1a T A 19: 3,378,441 V605E probably damaging Het
Ddx46 T C 13: 55,663,786 I600T possibly damaging Het
Dhx9 C A 1: 153,464,927 V656L probably damaging Het
Dnhd1 T A 7: 105,714,141 M3970K probably benign Het
Erv3 T C 2: 131,856,059 T127A possibly damaging Het
Fcer1a T C 1: 173,222,607 Y172C probably damaging Het
Gabra1 A G 11: 42,153,390 M167T probably damaging Het
Ggt1 A G 10: 75,585,909 H530R probably benign Het
Gli2 C A 1: 118,837,266 V1052L probably damaging Het
Gm4491 A C 14: 57,113,683 F84C unknown Het
Irf2bp1 C T 7: 19,005,815 T460I probably benign Het
Klf3 A G 5: 64,822,897 Y187C possibly damaging Het
Krt80 T C 15: 101,351,771 E287G probably benign Het
Lama4 G T 10: 39,072,751 V837F probably damaging Het
Lrig3 G T 10: 126,014,853 C1096F probably benign Het
Mtrr T C 13: 68,571,139 R328G possibly damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Obsl1 A T 1: 75,500,077 D744E probably damaging Het
Olfr1274-ps G A 2: 90,401,097 M145I probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pde4b A G 4: 102,255,281 T21A probably damaging Het
Phf20l1 G A 15: 66,641,903 G1003D probably damaging Het
Phtf1 A G 3: 103,997,577 T514A probably benign Het
Phykpl A G 11: 51,591,404 E115G possibly damaging Het
Pxmp2 C A 5: 110,286,078 probably benign Het
Reln A G 5: 22,004,211 L1123P possibly damaging Het
Rusc2 T C 4: 43,416,382 S563P probably damaging Het
Secisbp2 T G 13: 51,654,447 S83A probably damaging Het
Sema3c T A 5: 17,727,497 M666K probably benign Het
Serbp1 G T 6: 67,271,224 D114Y probably damaging Het
Sh3d21 T A 4: 126,151,483 T468S possibly damaging Het
Shroom3 T A 5: 92,950,619 D1319E probably benign Het
Skida1 T C 2: 18,046,575 R502G unknown Het
Slc25a12 C A 2: 71,298,642 G314C possibly damaging Het
Smg8 A G 11: 87,077,963 V989A probably benign Het
Spon2 G A 5: 33,216,500 P156S probably damaging Het
Stx1a A G 5: 135,037,516 N50S probably benign Het
Tmem151b C A 17: 45,546,880 V147L probably benign Het
Trim12c C T 7: 104,341,184 G362D unknown Het
Tsr1 T C 11: 74,908,309 V772A probably damaging Het
Tti2 A T 8: 31,153,522 K222* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r60 A G 7: 5,544,219 M294T probably null Het
Vmn2r6 T C 3: 64,556,063 E450G probably benign Het
Vmn2r60 T A 7: 42,136,531 F253I probably benign Het
Wnk4 A T 11: 101,269,252 D649V probably damaging Het
Zfhx4 T C 3: 5,329,465 S1040P probably benign Het
Zfp112 C T 7: 24,125,380 R262C probably benign Het
Zfp287 T A 11: 62,715,289 D264V probably benign Het
Zfp46 T C 4: 136,290,565 C237R probably damaging Het
Zfp773 C T 7: 7,132,695 E301K probably benign Het
Zswim2 A C 2: 83,917,960 V292G probably benign Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGAAAAGTCAGCCATTGTC -3'
(R):5'- AGTTATCCTAGAAGACAGATCCAC -3'

Sequencing Primer
(F):5'- GAAAAGTCAGCCATTGTCCTTGAGC -3'
(R):5'- GAGACCTCCCAATCTGACATTATAGG -3'
Posted On 2022-03-25