Incidental Mutation 'R9295:Vmn2r6'
ID 704527
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG667069, EG620718
Accession Numbers
Essential gene? Probably non essential (E-score: 0.241) question?
Stock # R9295 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64444916-64472855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64463484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 450 (E450G)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: E361G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: E361G

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: E450G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: E450G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 43,900,116 (GRCm39) V7E probably benign Het
Adam17 A G 12: 21,399,938 (GRCm39) V156A probably benign Het
Ankrd6 A T 4: 32,822,160 (GRCm39) V236E probably damaging Het
Apcdd1 C T 18: 63,055,731 (GRCm39) probably benign Het
C2cd3 C A 7: 100,081,734 (GRCm39) D1125E Het
Cacna2d2 A G 9: 107,386,419 (GRCm39) E182G probably benign Het
Cct3 A G 3: 88,212,430 (GRCm39) K139E probably benign Het
Cd96 G T 16: 45,938,244 (GRCm39) Q74K probably benign Het
Cdk5rap1 A T 2: 154,194,186 (GRCm39) I373N probably damaging Het
Cep350 A T 1: 155,738,051 (GRCm39) Y2597* probably null Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Clcn1 G A 6: 42,290,883 (GRCm39) G919E probably benign Het
Col6a4 G A 9: 105,957,734 (GRCm39) A30V probably damaging Het
Copa T C 1: 171,939,823 (GRCm39) C655R probably damaging Het
Cpt1a T A 19: 3,428,441 (GRCm39) V605E probably damaging Het
Ddx46 T C 13: 55,811,599 (GRCm39) I600T possibly damaging Het
Dhx9 C A 1: 153,340,673 (GRCm39) V656L probably damaging Het
Dnhd1 T A 7: 105,363,348 (GRCm39) M3970K probably benign Het
Ercc5 G T 1: 44,198,017 (GRCm39) V145F probably damaging Het
Erv3 T C 2: 131,697,979 (GRCm39) T127A possibly damaging Het
Fcer1a T C 1: 173,050,174 (GRCm39) Y172C probably damaging Het
Gabra1 A G 11: 42,044,217 (GRCm39) M167T probably damaging Het
Ggt1 A G 10: 75,421,743 (GRCm39) H530R probably benign Het
Gli2 C A 1: 118,764,996 (GRCm39) V1052L probably damaging Het
Gm4491 A C 14: 57,351,140 (GRCm39) F84C unknown Het
Irf2bp1 C T 7: 18,739,740 (GRCm39) T460I probably benign Het
Klf3 A G 5: 64,980,240 (GRCm39) Y187C possibly damaging Het
Krt80 T C 15: 101,249,652 (GRCm39) E287G probably benign Het
Lama4 G T 10: 38,948,747 (GRCm39) V837F probably damaging Het
Lrig3 G T 10: 125,850,722 (GRCm39) C1096F probably benign Het
Mtrr T C 13: 68,719,258 (GRCm39) R328G possibly damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Obsl1 A T 1: 75,476,721 (GRCm39) D744E probably damaging Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or4x13 G A 2: 90,231,441 (GRCm39) M145I probably benign Het
Pde4b A G 4: 102,112,478 (GRCm39) T21A probably damaging Het
Phf20l1 G A 15: 66,513,752 (GRCm39) G1003D probably damaging Het
Phtf1 A G 3: 103,904,893 (GRCm39) T514A probably benign Het
Phykpl A G 11: 51,482,231 (GRCm39) E115G possibly damaging Het
Pramel20 A G 4: 143,298,704 (GRCm39) T216A possibly damaging Het
Pxmp2 C A 5: 110,433,944 (GRCm39) probably benign Het
Reln A G 5: 22,209,209 (GRCm39) L1123P possibly damaging Het
Rusc2 T C 4: 43,416,382 (GRCm39) S563P probably damaging Het
Secisbp2 T G 13: 51,808,483 (GRCm39) S83A probably damaging Het
Sema3c T A 5: 17,932,495 (GRCm39) M666K probably benign Het
Serbp1 G T 6: 67,248,208 (GRCm39) D114Y probably damaging Het
Sh3d21 T A 4: 126,045,276 (GRCm39) T468S possibly damaging Het
Shroom3 T A 5: 93,098,478 (GRCm39) D1319E probably benign Het
Skida1 T C 2: 18,051,386 (GRCm39) R502G unknown Het
Slc25a12 C A 2: 71,128,986 (GRCm39) G314C possibly damaging Het
Smg8 A G 11: 86,968,789 (GRCm39) V989A probably benign Het
Spon2 G A 5: 33,373,844 (GRCm39) P156S probably damaging Het
Stx1a A G 5: 135,066,370 (GRCm39) N50S probably benign Het
Tmem151b C A 17: 45,857,806 (GRCm39) V147L probably benign Het
Trim12c C T 7: 103,990,391 (GRCm39) G362D unknown Het
Tsr1 T C 11: 74,799,135 (GRCm39) V772A probably damaging Het
Tti2 A T 8: 31,643,550 (GRCm39) K222* probably null Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vmn1r60 A G 7: 5,547,218 (GRCm39) M294T probably null Het
Vmn2r60 T A 7: 41,785,955 (GRCm39) F253I probably benign Het
Wnk4 A T 11: 101,160,078 (GRCm39) D649V probably damaging Het
Zfhx4 T C 3: 5,394,525 (GRCm39) S1040P probably benign Het
Zfp112 C T 7: 23,824,805 (GRCm39) R262C probably benign Het
Zfp287 T A 11: 62,606,115 (GRCm39) D264V probably benign Het
Zfp46 T C 4: 136,017,876 (GRCm39) C237R probably damaging Het
Zfp773 C T 7: 7,135,694 (GRCm39) E301K probably benign Het
Zswim2 A C 2: 83,748,304 (GRCm39) V292G probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64,445,525 (GRCm39) missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64,463,766 (GRCm39) missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64,445,323 (GRCm39) missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64,463,610 (GRCm39) missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64,463,749 (GRCm39) missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64,463,911 (GRCm39) missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64,463,917 (GRCm39) missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64,472,574 (GRCm39) missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64,445,428 (GRCm39) missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64,466,966 (GRCm39) nonsense probably null
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0208:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0427:Vmn2r6 UTSW 3 64,467,008 (GRCm39) missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64,463,723 (GRCm39) missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64,464,261 (GRCm39) missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64,445,487 (GRCm39) missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64,472,488 (GRCm39) missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64,445,694 (GRCm39) missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64,445,579 (GRCm39) nonsense probably null
R1498:Vmn2r6 UTSW 3 64,463,890 (GRCm39) missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64,463,698 (GRCm39) missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64,445,262 (GRCm39) missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64,463,519 (GRCm39) missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64,467,139 (GRCm39) missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64,463,773 (GRCm39) missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64,445,707 (GRCm39) missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64,463,929 (GRCm39) missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64,464,042 (GRCm39) missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64,463,893 (GRCm39) missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64,445,369 (GRCm39) missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64,445,145 (GRCm39) missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64,467,068 (GRCm39) missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64,454,829 (GRCm39) missense probably benign
R4934:Vmn2r6 UTSW 3 64,463,766 (GRCm39) missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64,445,207 (GRCm39) missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64,445,044 (GRCm39) missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64,464,015 (GRCm39) missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64,445,935 (GRCm39) missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64,445,411 (GRCm39) missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64,464,263 (GRCm39) missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64,463,454 (GRCm39) missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64,472,652 (GRCm39) missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64,463,953 (GRCm39) missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64,467,176 (GRCm39) missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64,445,424 (GRCm39) missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64,464,226 (GRCm39) missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64,454,801 (GRCm39) nonsense probably null
R6645:Vmn2r6 UTSW 3 64,464,297 (GRCm39) missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64,445,580 (GRCm39) missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64,464,195 (GRCm39) missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64,447,372 (GRCm39) nonsense probably null
R7562:Vmn2r6 UTSW 3 64,463,941 (GRCm39) missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64,472,683 (GRCm39) missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64,472,563 (GRCm39) missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64,463,991 (GRCm39) missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64,445,443 (GRCm39) missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64,467,241 (GRCm39) missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64,467,245 (GRCm39) missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64,455,064 (GRCm39) intron probably benign
R8169:Vmn2r6 UTSW 3 64,447,310 (GRCm39) missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64,463,526 (GRCm39) nonsense probably null
R8736:Vmn2r6 UTSW 3 64,467,221 (GRCm39) missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64,463,576 (GRCm39) missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64,464,277 (GRCm39) missense probably benign 0.12
R9206:Vmn2r6 UTSW 3 64,467,032 (GRCm39) missense probably damaging 0.97
R9332:Vmn2r6 UTSW 3 64,454,671 (GRCm39) missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64,445,724 (GRCm39) missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64,463,549 (GRCm39) missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64,464,081 (GRCm39) missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64,445,871 (GRCm39) missense probably benign
X0066:Vmn2r6 UTSW 3 64,454,799 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64,463,746 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCACCCAGACATGTTTTGATG -3'
(R):5'- AGCACTGTGCCATACAATGTGG -3'

Sequencing Primer
(F):5'- CACCCAGACATGTTTTGATGATATAC -3'
(R):5'- TGTGCCATACAATGTGGACCAC -3'
Posted On 2022-03-25