Incidental Mutation 'R9295:Vmn2r6'
ID 704527
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG620718, EG667069
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9295 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64537561-64565298 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64556063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 450 (E450G)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: E361G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: E361G

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: E450G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: E450G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,692 V7E probably benign Het
Adam17 A G 12: 21,349,937 V156A probably benign Het
Ankrd6 A T 4: 32,822,160 V236E probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
BC080695 A G 4: 143,572,134 T216A possibly damaging Het
C2cd3 C A 7: 100,432,527 D1125E Het
Cacna2d2 A G 9: 107,509,220 E182G probably benign Het
Cct3 A G 3: 88,305,123 K139E probably benign Het
Cd96 G T 16: 46,117,881 Q74K probably benign Het
Cdk5rap1 A T 2: 154,352,266 I373N probably damaging Het
Cep350 A T 1: 155,862,305 Y2597* probably null Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clcn1 G A 6: 42,313,949 G919E probably benign Het
Col6a4 G A 9: 106,080,535 A30V probably damaging Het
Copa T C 1: 172,112,256 C655R probably damaging Het
Cpt1a T A 19: 3,378,441 V605E probably damaging Het
Ddx46 T C 13: 55,663,786 I600T possibly damaging Het
Dhx9 C A 1: 153,464,927 V656L probably damaging Het
Dnhd1 T A 7: 105,714,141 M3970K probably benign Het
Ercc5 G T 1: 44,158,857 V145F probably damaging Het
Erv3 T C 2: 131,856,059 T127A possibly damaging Het
Fcer1a T C 1: 173,222,607 Y172C probably damaging Het
Gabra1 A G 11: 42,153,390 M167T probably damaging Het
Ggt1 A G 10: 75,585,909 H530R probably benign Het
Gli2 C A 1: 118,837,266 V1052L probably damaging Het
Gm4491 A C 14: 57,113,683 F84C unknown Het
Irf2bp1 C T 7: 19,005,815 T460I probably benign Het
Klf3 A G 5: 64,822,897 Y187C possibly damaging Het
Krt80 T C 15: 101,351,771 E287G probably benign Het
Lama4 G T 10: 39,072,751 V837F probably damaging Het
Lrig3 G T 10: 126,014,853 C1096F probably benign Het
Mtrr T C 13: 68,571,139 R328G possibly damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Obsl1 A T 1: 75,500,077 D744E probably damaging Het
Olfr1274-ps G A 2: 90,401,097 M145I probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pde4b A G 4: 102,255,281 T21A probably damaging Het
Phf20l1 G A 15: 66,641,903 G1003D probably damaging Het
Phtf1 A G 3: 103,997,577 T514A probably benign Het
Phykpl A G 11: 51,591,404 E115G possibly damaging Het
Pxmp2 C A 5: 110,286,078 probably benign Het
Reln A G 5: 22,004,211 L1123P possibly damaging Het
Rusc2 T C 4: 43,416,382 S563P probably damaging Het
Secisbp2 T G 13: 51,654,447 S83A probably damaging Het
Sema3c T A 5: 17,727,497 M666K probably benign Het
Serbp1 G T 6: 67,271,224 D114Y probably damaging Het
Sh3d21 T A 4: 126,151,483 T468S possibly damaging Het
Shroom3 T A 5: 92,950,619 D1319E probably benign Het
Skida1 T C 2: 18,046,575 R502G unknown Het
Slc25a12 C A 2: 71,298,642 G314C possibly damaging Het
Smg8 A G 11: 87,077,963 V989A probably benign Het
Spon2 G A 5: 33,216,500 P156S probably damaging Het
Stx1a A G 5: 135,037,516 N50S probably benign Het
Tmem151b C A 17: 45,546,880 V147L probably benign Het
Trim12c C T 7: 104,341,184 G362D unknown Het
Tsr1 T C 11: 74,908,309 V772A probably damaging Het
Tti2 A T 8: 31,153,522 K222* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r60 A G 7: 5,544,219 M294T probably null Het
Vmn2r60 T A 7: 42,136,531 F253I probably benign Het
Wnk4 A T 11: 101,269,252 D649V probably damaging Het
Zfhx4 T C 3: 5,329,465 S1040P probably benign Het
Zfp112 C T 7: 24,125,380 R262C probably benign Het
Zfp287 T A 11: 62,715,289 D264V probably benign Het
Zfp46 T C 4: 136,290,565 C237R probably damaging Het
Zfp773 C T 7: 7,132,695 E301K probably benign Het
Zswim2 A C 2: 83,917,960 V292G probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64556105 nonsense probably null
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64556155 missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64556856 missense probably benign 0.12
R9206:Vmn2r6 UTSW 3 64559611 missense probably damaging 0.97
R9332:Vmn2r6 UTSW 3 64547250 missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64538303 missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64556128 missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64556660 missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCACCCAGACATGTTTTGATG -3'
(R):5'- AGCACTGTGCCATACAATGTGG -3'

Sequencing Primer
(F):5'- CACCCAGACATGTTTTGATGATATAC -3'
(R):5'- TGTGCCATACAATGTGGACCAC -3'
Posted On 2022-03-25