Incidental Mutation 'R9295:Apcdd1'
ID 704579
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9295 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,692 V7E probably benign Het
Adam17 A G 12: 21,349,937 V156A probably benign Het
Ankrd6 A T 4: 32,822,160 V236E probably damaging Het
BC080695 A G 4: 143,572,134 T216A possibly damaging Het
C2cd3 C A 7: 100,432,527 D1125E Het
Cacna2d2 A G 9: 107,509,220 E182G probably benign Het
Cct3 A G 3: 88,305,123 K139E probably benign Het
Cd96 G T 16: 46,117,881 Q74K probably benign Het
Cdk5rap1 A T 2: 154,352,266 I373N probably damaging Het
Cep350 A T 1: 155,862,305 Y2597* probably null Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clcn1 G A 6: 42,313,949 G919E probably benign Het
Col6a4 G A 9: 106,080,535 A30V probably damaging Het
Copa T C 1: 172,112,256 C655R probably damaging Het
Cpt1a T A 19: 3,378,441 V605E probably damaging Het
Ddx46 T C 13: 55,663,786 I600T possibly damaging Het
Dhx9 C A 1: 153,464,927 V656L probably damaging Het
Dnhd1 T A 7: 105,714,141 M3970K probably benign Het
Ercc5 G T 1: 44,158,857 V145F probably damaging Het
Erv3 T C 2: 131,856,059 T127A possibly damaging Het
Fcer1a T C 1: 173,222,607 Y172C probably damaging Het
Gabra1 A G 11: 42,153,390 M167T probably damaging Het
Ggt1 A G 10: 75,585,909 H530R probably benign Het
Gli2 C A 1: 118,837,266 V1052L probably damaging Het
Gm4491 A C 14: 57,113,683 F84C unknown Het
Irf2bp1 C T 7: 19,005,815 T460I probably benign Het
Klf3 A G 5: 64,822,897 Y187C possibly damaging Het
Krt80 T C 15: 101,351,771 E287G probably benign Het
Lama4 G T 10: 39,072,751 V837F probably damaging Het
Lrig3 G T 10: 126,014,853 C1096F probably benign Het
Mtrr T C 13: 68,571,139 R328G possibly damaging Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Obsl1 A T 1: 75,500,077 D744E probably damaging Het
Olfr1274-ps G A 2: 90,401,097 M145I probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pde4b A G 4: 102,255,281 T21A probably damaging Het
Phf20l1 G A 15: 66,641,903 G1003D probably damaging Het
Phtf1 A G 3: 103,997,577 T514A probably benign Het
Phykpl A G 11: 51,591,404 E115G possibly damaging Het
Pxmp2 C A 5: 110,286,078 probably benign Het
Reln A G 5: 22,004,211 L1123P possibly damaging Het
Rusc2 T C 4: 43,416,382 S563P probably damaging Het
Secisbp2 T G 13: 51,654,447 S83A probably damaging Het
Sema3c T A 5: 17,727,497 M666K probably benign Het
Serbp1 G T 6: 67,271,224 D114Y probably damaging Het
Sh3d21 T A 4: 126,151,483 T468S possibly damaging Het
Shroom3 T A 5: 92,950,619 D1319E probably benign Het
Skida1 T C 2: 18,046,575 R502G unknown Het
Slc25a12 C A 2: 71,298,642 G314C possibly damaging Het
Smg8 A G 11: 87,077,963 V989A probably benign Het
Spon2 G A 5: 33,216,500 P156S probably damaging Het
Stx1a A G 5: 135,037,516 N50S probably benign Het
Tmem151b C A 17: 45,546,880 V147L probably benign Het
Trim12c C T 7: 104,341,184 G362D unknown Het
Tsr1 T C 11: 74,908,309 V772A probably damaging Het
Tti2 A T 8: 31,153,522 K222* probably null Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r60 A G 7: 5,544,219 M294T probably null Het
Vmn2r6 T C 3: 64,556,063 E450G probably benign Het
Vmn2r60 T A 7: 42,136,531 F253I probably benign Het
Wnk4 A T 11: 101,269,252 D649V probably damaging Het
Zfhx4 T C 3: 5,329,465 S1040P probably benign Het
Zfp112 C T 7: 24,125,380 R262C probably benign Het
Zfp287 T A 11: 62,715,289 D264V probably benign Het
Zfp46 T C 4: 136,290,565 C237R probably damaging Het
Zfp773 C T 7: 7,132,695 E301K probably benign Het
Zswim2 A C 2: 83,917,960 V292G probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- TTCCAGAAAGAACACTGCAGCG -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-03-25