Incidental Mutation 'R9296:Usp32'
ID 704615
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9296 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85017652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1076 (I1076T)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: I1076T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I1076T

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 T G 6: 87,137,427 probably benign Het
Aox1 A T 1: 58,085,453 Y951F probably damaging Het
Arhgap44 G T 11: 65,067,107 A83E probably damaging Het
Bmpr2 T C 1: 59,867,343 S532P probably damaging Het
Brd7 T C 8: 88,332,932 I617V possibly damaging Het
Brsk2 A C 7: 141,998,638 S620R probably benign Het
C3 T C 17: 57,204,291 M1604V probably benign Het
Cacna2d1 G A 5: 16,359,070 R917H probably damaging Het
Ccdc17 T A 4: 116,599,389 F452I probably damaging Het
Cfap221 T C 1: 119,955,737 I235V probably null Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Ciita G A 16: 10,503,948 probably null Het
Cxcl10 T C 5: 92,348,138 K47E probably damaging Het
Cyp2d12 C T 15: 82,556,234 Q75* probably null Het
Cyp4f18 C T 8: 72,002,457 V92M probably benign Het
D930020B18Rik A G 10: 121,661,106 R149G possibly damaging Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dmtf1 A C 5: 9,140,467 D82E probably benign Het
Dnah1 T C 14: 31,274,054 probably null Het
Eps15 T G 4: 109,315,892 D183E possibly damaging Het
Fbln5 A T 12: 101,814,594 I7K probably benign Het
Fermt3 C T 19: 7,003,497 E289K possibly damaging Het
Gm10762 T A 2: 128,967,229 R67W unknown Het
Gm5089 A G 14: 122,436,142 S56P unknown Het
Gm8909 C T 17: 36,168,277 G27R unknown Het
Itih1 A G 14: 30,931,294 F730L probably benign Het
Macf1 T C 4: 123,506,453 H683R probably damaging Het
Mapk3 T A 7: 126,764,346 F297L Het
Mfap3l G A 8: 60,671,581 V286I possibly damaging Het
Myh4 A G 11: 67,255,304 K1396R possibly damaging Het
Mylk3 A T 8: 85,358,932 S324R probably benign Het
Ndufv3 T C 17: 31,520,223 S4P probably benign Het
Nebl A T 2: 17,424,640 probably benign Het
Nol4 A T 18: 22,823,331 S119T Het
Olfr424 A T 1: 174,137,269 H175L probably benign Het
Pcdhgb4 T A 18: 37,720,724 S57R probably benign Het
Pcyox1 A G 6: 86,391,753 L261P probably damaging Het
Plekhm3 G T 1: 64,922,480 H206N probably benign Het
Polr2a T C 11: 69,734,736 T1863A probably benign Het
Prl7c1 T A 13: 27,778,829 I64L probably benign Het
Psg17 A T 7: 18,820,066 N86K probably benign Het
Rab37 A G 11: 115,154,239 E14G probably benign Het
Rad54l2 T A 9: 106,702,743 K976N probably damaging Het
Rnf213 A T 11: 119,443,795 probably benign Het
Sdha A T 13: 74,323,943 D602E probably damaging Het
Slc22a30 T A 19: 8,386,755 T186S probably benign Het
Slc22a4 A T 11: 53,997,391 C270* probably null Het
Slc6a4 T C 11: 77,018,284 V374A probably benign Het
Spg11 T C 2: 122,114,694 D115G probably benign Het
Susd1 T C 4: 59,427,865 probably benign Het
Tor1a A T 2: 30,961,092 M286K probably damaging Het
Trim12c G T 7: 104,344,978 A223D Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn2r101 G A 17: 19,589,785 D278N probably damaging Het
Zan C T 5: 137,388,876 V4972I unknown Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTCTTTCCAGTGTTCGG -3'
(R):5'- CTACAAATGGACTGTTTACCTTGAC -3'

Sequencing Primer
(F):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
(R):5'- ACCTTGACTACCAATGGGGATCTG -3'
Posted On 2022-03-25