Incidental Mutation 'R9296:Usp32'
ID 704615
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 2900074J03Rik, 6430526O11Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9296 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84875268-85030987 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84908478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1076 (I1076T)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: I1076T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I1076T

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 T G 6: 87,114,409 (GRCm39) probably benign Het
Aox1 A T 1: 58,124,612 (GRCm39) Y951F probably damaging Het
Arhgap44 G T 11: 64,957,933 (GRCm39) A83E probably damaging Het
Bmpr2 T C 1: 59,906,502 (GRCm39) S532P probably damaging Het
Brd7 T C 8: 89,059,560 (GRCm39) I617V possibly damaging Het
Brsk2 A C 7: 141,552,375 (GRCm39) S620R probably benign Het
C3 T C 17: 57,511,291 (GRCm39) M1604V probably benign Het
Cacna2d1 G A 5: 16,564,068 (GRCm39) R917H probably damaging Het
Ccdc17 T A 4: 116,456,586 (GRCm39) F452I probably damaging Het
Cfap221 T C 1: 119,883,467 (GRCm39) I235V probably null Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Ciita G A 16: 10,321,812 (GRCm39) probably null Het
Cxcl10 T C 5: 92,495,997 (GRCm39) K47E probably damaging Het
Cyp2d12 C T 15: 82,440,435 (GRCm39) Q75* probably null Het
Cyp4f18 C T 8: 72,756,301 (GRCm39) V92M probably benign Het
D930020B18Rik A G 10: 121,497,011 (GRCm39) R149G possibly damaging Het
Dlgap4 G T 2: 156,546,514 (GRCm39) R394L possibly damaging Het
Dmtf1 A C 5: 9,190,467 (GRCm39) D82E probably benign Het
Dnah1 T C 14: 30,996,011 (GRCm39) probably null Het
Eps15 T G 4: 109,173,089 (GRCm39) D183E possibly damaging Het
Fbln5 A T 12: 101,780,853 (GRCm39) I7K probably benign Het
Fermt3 C T 19: 6,980,865 (GRCm39) E289K possibly damaging Het
Gm10762 T A 2: 128,809,149 (GRCm39) R67W unknown Het
Gm5089 A G 14: 122,673,554 (GRCm39) S56P unknown Het
H2-T5 C T 17: 36,479,169 (GRCm39) G27R unknown Het
Itih1 A G 14: 30,653,251 (GRCm39) F730L probably benign Het
Macf1 T C 4: 123,400,246 (GRCm39) H683R probably damaging Het
Mapk3 T A 7: 126,363,518 (GRCm39) F297L Het
Mfap3l G A 8: 61,124,615 (GRCm39) V286I possibly damaging Het
Myh4 A G 11: 67,146,130 (GRCm39) K1396R possibly damaging Het
Mylk3 A T 8: 86,085,561 (GRCm39) S324R probably benign Het
Ndufv3 T C 17: 31,739,197 (GRCm39) S4P probably benign Het
Nebl A T 2: 17,429,451 (GRCm39) probably benign Het
Nol4 A T 18: 22,956,388 (GRCm39) S119T Het
Or6k4 A T 1: 173,964,835 (GRCm39) H175L probably benign Het
Pcdhgb4 T A 18: 37,853,777 (GRCm39) S57R probably benign Het
Pcyox1 A G 6: 86,368,735 (GRCm39) L261P probably damaging Het
Plekhm3 G T 1: 64,961,639 (GRCm39) H206N probably benign Het
Polr2a T C 11: 69,625,562 (GRCm39) T1863A probably benign Het
Prl7c1 T A 13: 27,962,812 (GRCm39) I64L probably benign Het
Psg17 A T 7: 18,553,991 (GRCm39) N86K probably benign Het
Rab37 A G 11: 115,045,065 (GRCm39) E14G probably benign Het
Rad54l2 T A 9: 106,579,942 (GRCm39) K976N probably damaging Het
Rnf213 A T 11: 119,334,621 (GRCm39) probably benign Het
Sdha A T 13: 74,472,062 (GRCm39) D602E probably damaging Het
Slc22a30 T A 19: 8,364,119 (GRCm39) T186S probably benign Het
Slc22a4 A T 11: 53,888,217 (GRCm39) C270* probably null Het
Slc6a4 T C 11: 76,909,110 (GRCm39) V374A probably benign Het
Spg11 T C 2: 121,945,175 (GRCm39) D115G probably benign Het
Susd1 T C 4: 59,427,865 (GRCm39) probably benign Het
Tor1a A T 2: 30,851,104 (GRCm39) M286K probably damaging Het
Trim12c G T 7: 103,994,185 (GRCm39) A223D Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vmn2r101 G A 17: 19,810,047 (GRCm39) D278N probably damaging Het
Zan C T 5: 137,387,138 (GRCm39) V4972I unknown Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84,885,252 (GRCm39) missense probably damaging 1.00
IGL00701:Usp32 APN 11 84,949,951 (GRCm39) splice site probably null
IGL00848:Usp32 APN 11 84,942,007 (GRCm39) splice site probably benign
IGL00934:Usp32 APN 11 84,897,902 (GRCm39) missense probably damaging 1.00
IGL01019:Usp32 APN 11 84,930,091 (GRCm39) missense probably damaging 0.97
IGL01302:Usp32 APN 11 84,879,308 (GRCm39) missense probably benign 0.05
IGL01444:Usp32 APN 11 84,949,990 (GRCm39) missense probably damaging 0.97
IGL01575:Usp32 APN 11 84,913,628 (GRCm39) missense probably damaging 1.00
IGL01981:Usp32 APN 11 84,927,350 (GRCm39) missense probably benign 0.02
IGL02118:Usp32 APN 11 84,923,003 (GRCm39) nonsense probably null
IGL02159:Usp32 APN 11 84,896,628 (GRCm39) splice site probably null
IGL02227:Usp32 APN 11 84,877,307 (GRCm39) missense probably damaging 1.00
IGL02363:Usp32 APN 11 84,935,613 (GRCm39) missense probably benign 0.01
IGL02524:Usp32 APN 11 84,900,837 (GRCm39) nonsense probably null
IGL02613:Usp32 APN 11 84,930,896 (GRCm39) missense probably damaging 0.99
IGL02720:Usp32 APN 11 84,897,817 (GRCm39) critical splice donor site probably null
IGL02738:Usp32 APN 11 84,974,632 (GRCm39) missense probably damaging 1.00
IGL02929:Usp32 APN 11 84,879,198 (GRCm39) missense probably benign 0.01
IGL03303:Usp32 APN 11 84,913,658 (GRCm39) missense probably damaging 1.00
BB010:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
BB020:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 84,900,900 (GRCm39) missense probably damaging 1.00
R0026:Usp32 UTSW 11 84,922,900 (GRCm39) missense possibly damaging 0.48
R0295:Usp32 UTSW 11 84,944,518 (GRCm39) missense probably damaging 0.98
R1320:Usp32 UTSW 11 84,908,619 (GRCm39) missense probably damaging 0.98
R1712:Usp32 UTSW 11 84,933,406 (GRCm39) missense probably benign 0.12
R1922:Usp32 UTSW 11 84,897,830 (GRCm39) nonsense probably null
R1973:Usp32 UTSW 11 84,994,757 (GRCm39) missense probably benign 0.09
R2010:Usp32 UTSW 11 84,930,830 (GRCm39) missense probably damaging 0.98
R2082:Usp32 UTSW 11 84,921,338 (GRCm39) missense probably damaging 0.99
R2355:Usp32 UTSW 11 84,896,735 (GRCm39) missense probably benign 0.34
R3147:Usp32 UTSW 11 84,919,913 (GRCm39) missense probably damaging 1.00
R3160:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3162:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3716:Usp32 UTSW 11 84,933,389 (GRCm39) missense probably damaging 1.00
R3816:Usp32 UTSW 11 84,885,210 (GRCm39) critical splice donor site probably null
R3870:Usp32 UTSW 11 84,897,881 (GRCm39) nonsense probably null
R3871:Usp32 UTSW 11 84,971,982 (GRCm39) missense probably null 0.81
R4041:Usp32 UTSW 11 84,908,565 (GRCm39) missense probably benign 0.40
R4079:Usp32 UTSW 11 84,930,055 (GRCm39) missense probably damaging 0.98
R4332:Usp32 UTSW 11 84,994,804 (GRCm39) missense possibly damaging 0.79
R4396:Usp32 UTSW 11 84,944,801 (GRCm39) missense probably benign
R4580:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4620:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4744:Usp32 UTSW 11 84,885,219 (GRCm39) missense probably damaging 1.00
R4909:Usp32 UTSW 11 84,946,598 (GRCm39) nonsense probably null
R5056:Usp32 UTSW 11 84,917,621 (GRCm39) missense probably benign 0.07
R5111:Usp32 UTSW 11 84,968,157 (GRCm39) missense possibly damaging 0.95
R5213:Usp32 UTSW 11 84,913,085 (GRCm39) missense probably damaging 1.00
R5308:Usp32 UTSW 11 84,908,544 (GRCm39) missense probably benign 0.12
R5381:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably benign
R5538:Usp32 UTSW 11 84,908,612 (GRCm39) missense possibly damaging 0.65
R5659:Usp32 UTSW 11 84,968,240 (GRCm39) missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84,883,277 (GRCm39) critical splice donor site probably null
R6011:Usp32 UTSW 11 84,922,923 (GRCm39) missense possibly damaging 0.70
R6029:Usp32 UTSW 11 84,916,408 (GRCm39) missense probably damaging 0.99
R6074:Usp32 UTSW 11 84,885,399 (GRCm39) missense probably benign 0.00
R6331:Usp32 UTSW 11 84,877,402 (GRCm39) missense possibly damaging 0.92
R6353:Usp32 UTSW 11 84,913,107 (GRCm39) missense probably benign
R6714:Usp32 UTSW 11 84,917,696 (GRCm39) missense probably damaging 0.99
R6778:Usp32 UTSW 11 84,916,512 (GRCm39) missense probably benign 0.00
R6988:Usp32 UTSW 11 84,900,969 (GRCm39) missense probably benign 0.35
R6992:Usp32 UTSW 11 84,922,914 (GRCm39) missense probably damaging 0.99
R7182:Usp32 UTSW 11 84,930,996 (GRCm39) missense probably benign 0.34
R7186:Usp32 UTSW 11 84,942,060 (GRCm39) missense probably benign 0.45
R7198:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7201:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7469:Usp32 UTSW 11 84,879,379 (GRCm39) missense possibly damaging 0.94
R7502:Usp32 UTSW 11 84,913,724 (GRCm39) missense possibly damaging 0.48
R7513:Usp32 UTSW 11 84,917,938 (GRCm39) nonsense probably null
R7629:Usp32 UTSW 11 84,910,681 (GRCm39) frame shift probably null
R7703:Usp32 UTSW 11 84,968,153 (GRCm39) missense probably damaging 0.99
R7741:Usp32 UTSW 11 84,878,107 (GRCm39) missense probably damaging 0.99
R7765:Usp32 UTSW 11 84,885,234 (GRCm39) missense probably damaging 1.00
R7933:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
R7973:Usp32 UTSW 11 84,913,634 (GRCm39) missense probably damaging 0.99
R7989:Usp32 UTSW 11 84,925,126 (GRCm39) missense
R7998:Usp32 UTSW 11 84,885,252 (GRCm39) missense probably damaging 1.00
R8292:Usp32 UTSW 11 84,968,227 (GRCm39) missense probably damaging 0.99
R8305:Usp32 UTSW 11 84,923,011 (GRCm39) missense possibly damaging 0.83
R8548:Usp32 UTSW 11 84,908,653 (GRCm39) missense possibly damaging 0.52
R8924:Usp32 UTSW 11 84,916,370 (GRCm39) missense probably damaging 0.98
R9002:Usp32 UTSW 11 84,944,777 (GRCm39) missense probably damaging 0.96
R9145:Usp32 UTSW 11 84,913,118 (GRCm39) missense probably damaging 1.00
R9209:Usp32 UTSW 11 84,930,838 (GRCm39) missense probably damaging 0.98
R9211:Usp32 UTSW 11 84,913,559 (GRCm39) missense probably damaging 1.00
R9310:Usp32 UTSW 11 84,942,028 (GRCm39) missense probably benign 0.29
R9417:Usp32 UTSW 11 84,885,369 (GRCm39) missense probably damaging 1.00
R9514:Usp32 UTSW 11 84,913,560 (GRCm39) missense probably damaging 0.99
R9652:Usp32 UTSW 11 84,921,317 (GRCm39) missense probably damaging 0.97
R9723:Usp32 UTSW 11 84,935,536 (GRCm39) nonsense probably null
R9757:Usp32 UTSW 11 84,968,155 (GRCm39) nonsense probably null
X0028:Usp32 UTSW 11 84,883,432 (GRCm39) missense probably benign 0.05
Z1177:Usp32 UTSW 11 84,879,438 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTCTTTCCAGTGTTCGG -3'
(R):5'- CTACAAATGGACTGTTTACCTTGAC -3'

Sequencing Primer
(F):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
(R):5'- ACCTTGACTACCAATGGGGATCTG -3'
Posted On 2022-03-25