Incidental Mutation 'R9297:Cadps2'
ID 704651
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9297 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23496887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 453 (Y453H)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: Y453H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115356
AA Change: Y453H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
AA Change: Y98H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: Y98H

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: Y424H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: Y424H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: Y424H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: Y424H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,599,534 (GRCm39) Q22R probably benign Het
Adamts20 A G 15: 94,301,321 (GRCm39) S68P possibly damaging Het
Adcy6 A T 15: 98,491,466 (GRCm39) N1044K possibly damaging Het
Ak9 T G 10: 41,299,081 (GRCm39) M1594R unknown Het
Alkbh3 A G 2: 93,835,082 (GRCm39) S88P probably damaging Het
Angpt1 A G 15: 42,301,751 (GRCm39) I419T probably benign Het
Ankrd31 A T 13: 97,015,085 (GRCm39) L1451F probably benign Het
Ap1b1 T C 11: 4,990,157 (GRCm39) I860T probably benign Het
Apcdd1 C T 18: 63,055,731 (GRCm39) probably benign Het
Astn2 T C 4: 65,460,960 (GRCm39) D1058G possibly damaging Het
Atg3 A G 16: 44,987,371 (GRCm39) H48R possibly damaging Het
Bnc2 A C 4: 84,474,136 (GRCm39) probably benign Het
Catsperg1 T C 7: 28,891,085 (GRCm39) T653A probably benign Het
Ccdc102a A G 8: 95,638,120 (GRCm39) S249P possibly damaging Het
Ccdc125 A G 13: 100,832,920 (GRCm39) Y499C probably damaging Het
Ccdc141 A G 2: 76,842,028 (GRCm39) F1468L probably benign Het
Ccdc162 C A 10: 41,506,110 (GRCm39) M893I probably benign Het
Ccdc33 C A 9: 57,993,876 (GRCm39) W335L possibly damaging Het
Chn2 T A 6: 54,272,840 (GRCm39) Y355N probably damaging Het
Clec4g A G 8: 3,766,500 (GRCm39) M267T probably damaging Het
Cpa6 A T 1: 10,554,273 (GRCm39) D111E possibly damaging Het
Crlf3 A G 11: 79,950,031 (GRCm39) C200R probably damaging Het
Cyp4a10 T C 4: 115,378,375 (GRCm39) S164P probably damaging Het
Def6 A G 17: 28,436,714 (GRCm39) N126S probably damaging Het
Diaph1 G A 18: 38,022,828 (GRCm39) T782I probably benign Het
Dnah5 A C 15: 28,204,054 (GRCm39) probably benign Het
Eme1 A T 11: 94,541,614 (GRCm39) S69R probably benign Het
Fat3 A T 9: 15,908,996 (GRCm39) D2335E probably damaging Het
Fstl4 A G 11: 53,024,973 (GRCm39) K282E possibly damaging Het
Galnt7 T C 8: 57,995,555 (GRCm39) E380G probably damaging Het
Gm973 A T 1: 59,583,829 (GRCm39) Y204F probably damaging Het
Hace1 T A 10: 45,528,769 (GRCm39) S337T probably benign Het
Ipo8 C A 6: 148,703,076 (GRCm39) C416F possibly damaging Het
Kcnt2 T C 1: 140,352,933 (GRCm39) I214T probably damaging Het
Kdelr3 C A 15: 79,411,275 (GRCm39) L203I probably benign Het
Kif26b C T 1: 178,543,374 (GRCm39) Q336* probably null Het
Krt36 A G 11: 99,994,271 (GRCm39) Y269H probably damaging Het
Lamc1 G T 1: 153,127,746 (GRCm39) R386S probably damaging Het
Lipc T A 9: 70,727,736 (GRCm39) D122V probably damaging Het
Lrba A G 3: 86,280,873 (GRCm39) T1841A probably damaging Het
Lrit1 T A 14: 36,783,993 (GRCm39) D440E probably damaging Het
Map4 T C 9: 109,882,480 (GRCm39) I448T probably benign Het
Megf8 G T 7: 25,030,511 (GRCm39) C488F probably damaging Het
Mllt6 A G 11: 97,563,314 (GRCm39) E299G probably damaging Het
Mpst G T 15: 78,294,642 (GRCm39) V125L probably damaging Het
Msx1 G A 5: 37,981,756 (GRCm39) probably benign Het
Muc2 A G 7: 141,302,759 (GRCm39) E473G Het
Myo15a A G 11: 60,385,899 (GRCm39) R602G probably null Het
Myod1 A T 7: 46,026,356 (GRCm39) H87L probably damaging Het
Nid1 T C 13: 13,650,897 (GRCm39) V478A possibly damaging Het
Obscn A T 11: 58,898,359 (GRCm39) I6634N unknown Het
Or52ab7 T A 7: 102,978,583 (GRCm39) Y297N probably damaging Het
Or52e7 T C 7: 104,684,830 (GRCm39) Y142H probably damaging Het
Or8k22 A G 2: 86,163,188 (GRCm39) Y171H probably benign Het
Pdgfrl C T 8: 41,391,268 (GRCm39) S66F probably damaging Het
Phf20 G A 2: 156,115,690 (GRCm39) R337H probably benign Het
Pkhd1 T A 1: 20,293,118 (GRCm39) Y2834F probably benign Het
Plekhg4 A C 8: 106,105,907 (GRCm39) E768A probably damaging Het
Prss37 A T 6: 40,491,909 (GRCm39) Y224N probably damaging Het
Ptprs A T 17: 56,765,257 (GRCm39) V9E probably damaging Het
Ptprt A G 2: 161,417,698 (GRCm39) L926S probably benign Het
Rgl1 G A 1: 152,400,454 (GRCm39) T649I possibly damaging Het
Serpinf1 A G 11: 75,307,251 (GRCm39) S29P probably damaging Het
Skint6 A T 4: 112,668,717 (GRCm39) D1119E probably benign Het
Snw1 T C 12: 87,505,674 (GRCm39) K255E probably damaging Het
Sox6 T C 7: 115,261,557 (GRCm39) I220V probably benign Het
Stimate T A 14: 30,588,639 (GRCm39) V122E probably damaging Het
Tas2r114 A G 6: 131,666,287 (GRCm39) I247T probably damaging Het
Tmem145 C T 7: 25,008,257 (GRCm39) T280M probably damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Zfp219 T C 14: 52,246,494 (GRCm39) H211R probably damaging Het
Zfp42 T C 8: 43,748,772 (GRCm39) N243S possibly damaging Het
Zkscan4 T A 13: 21,668,201 (GRCm39) S246R probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GAATGTCTGATACCTTGGTTTCCC -3'
(R):5'- AAAATCCGCCTGCTATGGTG -3'

Sequencing Primer
(F):5'- TAGACTGAAATGGAGTCCCCCG -3'
(R):5'- TATGGTGGGGGAGCACC -3'
Posted On 2022-03-25