Incidental Mutation 'R9297:Cadps2'
ID 704651
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9297 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23496888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 453 (Y453H)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: Y453H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115356
AA Change: Y453H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
AA Change: Y98H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: Y98H

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: Y424H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: Y424H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: Y453H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: Y453H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: Y424H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: Y424H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,802,646 Q22R probably benign Het
Adamts20 A G 15: 94,403,440 S68P possibly damaging Het
Adcy6 A T 15: 98,593,585 N1044K possibly damaging Het
Ak9 T G 10: 41,423,085 M1594R unknown Het
Alkbh3 A G 2: 94,004,737 S88P probably damaging Het
Angpt1 A G 15: 42,438,355 I419T probably benign Het
Ankrd31 A T 13: 96,878,577 L1451F probably benign Het
Ap1b1 T C 11: 5,040,157 I860T probably benign Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Astn2 T C 4: 65,542,723 D1058G possibly damaging Het
Atg3 A G 16: 45,167,008 H48R possibly damaging Het
Catsperg1 T C 7: 29,191,660 T653A probably benign Het
Ccdc102a A G 8: 94,911,492 S249P possibly damaging Het
Ccdc125 A G 13: 100,696,412 Y499C probably damaging Het
Ccdc141 A G 2: 77,011,684 F1468L probably benign Het
Ccdc162 C A 10: 41,630,114 M893I probably benign Het
Ccdc33 C A 9: 58,086,593 W335L possibly damaging Het
Chn2 T A 6: 54,295,855 Y355N probably damaging Het
Clec4g A G 8: 3,716,500 M267T probably damaging Het
Cpa6 A T 1: 10,484,048 D111E possibly damaging Het
Crlf3 A G 11: 80,059,205 C200R probably damaging Het
Cyp4a10 T C 4: 115,521,178 S164P probably damaging Het
Def6 A G 17: 28,217,740 N126S probably damaging Het
Diaph1 G A 18: 37,889,775 T782I probably benign Het
Dnah5 A C 15: 28,203,908 probably benign Het
Eme1 A T 11: 94,650,788 S69R probably benign Het
Fat3 A T 9: 15,997,700 D2335E probably damaging Het
Fstl4 A G 11: 53,134,146 K282E possibly damaging Het
Galnt7 T C 8: 57,542,521 E380G probably damaging Het
Gm973 A T 1: 59,544,670 Y204F probably damaging Het
Hace1 T A 10: 45,652,673 S337T probably benign Het
Ipo8 C A 6: 148,801,578 C416F possibly damaging Het
Kcnt2 T C 1: 140,425,195 I214T probably damaging Het
Kdelr3 C A 15: 79,527,074 L203I probably benign Het
Kif26b C T 1: 178,715,809 Q336* probably null Het
Krt36 A G 11: 100,103,445 Y269H probably damaging Het
Lamc1 G T 1: 153,252,000 R386S probably damaging Het
Lipc T A 9: 70,820,454 D122V probably damaging Het
Lrba A G 3: 86,373,566 T1841A probably damaging Het
Lrit1 T A 14: 37,062,036 D440E probably damaging Het
Map4 T C 9: 110,053,412 I448T probably benign Het
Megf8 G T 7: 25,331,086 C488F probably damaging Het
Mllt6 A G 11: 97,672,488 E299G probably damaging Het
Mpst G T 15: 78,410,442 V125L probably damaging Het
Msx1 G A 5: 37,824,412 probably benign Het
Muc2 A G 7: 141,749,022 E473G Het
Myo15 A G 11: 60,495,073 R602G probably null Het
Myod1 A T 7: 46,376,932 H87L probably damaging Het
Nid1 T C 13: 13,476,312 V478A possibly damaging Het
Obscn A T 11: 59,007,533 I6634N unknown Het
Olfr1054 A G 2: 86,332,844 Y171H probably benign Het
Olfr598 T A 7: 103,329,376 Y297N probably damaging Het
Olfr676 T C 7: 105,035,623 Y142H probably damaging Het
Pdgfrl C T 8: 40,938,231 S66F probably damaging Het
Phf20 G A 2: 156,273,770 R337H probably benign Het
Pkhd1 T A 1: 20,222,894 Y2834F probably benign Het
Plekhg4 A C 8: 105,379,275 E768A probably damaging Het
Prss37 A T 6: 40,514,975 Y224N probably damaging Het
Ptprs A T 17: 56,458,257 V9E probably damaging Het
Ptprt A G 2: 161,575,778 L926S probably benign Het
Rgl1 G A 1: 152,524,703 T649I possibly damaging Het
Serpinf1 A G 11: 75,416,425 S29P probably damaging Het
Skint6 A T 4: 112,811,520 D1119E probably benign Het
Snw1 T C 12: 87,458,904 K255E probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Tas2r114 A G 6: 131,689,324 I247T probably damaging Het
Tmem110 T A 14: 30,866,682 V122E probably damaging Het
Tmem145 C T 7: 25,308,832 T280M probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp219 T C 14: 52,009,037 H211R probably damaging Het
Zfp42 T C 8: 43,295,735 N243S possibly damaging Het
Zkscan4 T A 13: 21,484,031 S246R probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9228:Cadps2 UTSW 6 23688928 missense probably benign 0.00
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
R9447:Cadps2 UTSW 6 23323298 missense probably damaging 0.96
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTCTGATACCTTGGTTTCCC -3'
(R):5'- AAAATCCGCCTGCTATGGTG -3'

Sequencing Primer
(F):5'- TAGACTGAAATGGAGTCCCCCG -3'
(R):5'- TATGGTGGGGGAGCACC -3'
Posted On 2022-03-25