Incidental Mutation 'R9297:Apcdd1'
ID 704705
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9297 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,802,646 Q22R probably benign Het
Adamts20 A G 15: 94,403,440 S68P possibly damaging Het
Adcy6 A T 15: 98,593,585 N1044K possibly damaging Het
Ak9 T G 10: 41,423,085 M1594R unknown Het
Alkbh3 A G 2: 94,004,737 S88P probably damaging Het
Angpt1 A G 15: 42,438,355 I419T probably benign Het
Ankrd31 A T 13: 96,878,577 L1451F probably benign Het
Ap1b1 T C 11: 5,040,157 I860T probably benign Het
Astn2 T C 4: 65,542,723 D1058G possibly damaging Het
Atg3 A G 16: 45,167,008 H48R possibly damaging Het
Cadps2 A G 6: 23,496,888 Y453H probably benign Het
Catsperg1 T C 7: 29,191,660 T653A probably benign Het
Ccdc102a A G 8: 94,911,492 S249P possibly damaging Het
Ccdc125 A G 13: 100,696,412 Y499C probably damaging Het
Ccdc141 A G 2: 77,011,684 F1468L probably benign Het
Ccdc162 C A 10: 41,630,114 M893I probably benign Het
Ccdc33 C A 9: 58,086,593 W335L possibly damaging Het
Chn2 T A 6: 54,295,855 Y355N probably damaging Het
Clec4g A G 8: 3,716,500 M267T probably damaging Het
Cpa6 A T 1: 10,484,048 D111E possibly damaging Het
Crlf3 A G 11: 80,059,205 C200R probably damaging Het
Cyp4a10 T C 4: 115,521,178 S164P probably damaging Het
Def6 A G 17: 28,217,740 N126S probably damaging Het
Diaph1 G A 18: 37,889,775 T782I probably benign Het
Dnah5 A C 15: 28,203,908 probably benign Het
Eme1 A T 11: 94,650,788 S69R probably benign Het
Fat3 A T 9: 15,997,700 D2335E probably damaging Het
Fstl4 A G 11: 53,134,146 K282E possibly damaging Het
Galnt7 T C 8: 57,542,521 E380G probably damaging Het
Gm973 A T 1: 59,544,670 Y204F probably damaging Het
Hace1 T A 10: 45,652,673 S337T probably benign Het
Ipo8 C A 6: 148,801,578 C416F possibly damaging Het
Kcnt2 T C 1: 140,425,195 I214T probably damaging Het
Kdelr3 C A 15: 79,527,074 L203I probably benign Het
Kif26b C T 1: 178,715,809 Q336* probably null Het
Krt36 A G 11: 100,103,445 Y269H probably damaging Het
Lamc1 G T 1: 153,252,000 R386S probably damaging Het
Lipc T A 9: 70,820,454 D122V probably damaging Het
Lrba A G 3: 86,373,566 T1841A probably damaging Het
Lrit1 T A 14: 37,062,036 D440E probably damaging Het
Map4 T C 9: 110,053,412 I448T probably benign Het
Megf8 G T 7: 25,331,086 C488F probably damaging Het
Mllt6 A G 11: 97,672,488 E299G probably damaging Het
Mpst G T 15: 78,410,442 V125L probably damaging Het
Msx1 G A 5: 37,824,412 probably benign Het
Muc2 A G 7: 141,749,022 E473G Het
Myo15 A G 11: 60,495,073 R602G probably null Het
Myod1 A T 7: 46,376,932 H87L probably damaging Het
Nid1 T C 13: 13,476,312 V478A possibly damaging Het
Obscn A T 11: 59,007,533 I6634N unknown Het
Olfr1054 A G 2: 86,332,844 Y171H probably benign Het
Olfr598 T A 7: 103,329,376 Y297N probably damaging Het
Olfr676 T C 7: 105,035,623 Y142H probably damaging Het
Pdgfrl C T 8: 40,938,231 S66F probably damaging Het
Phf20 G A 2: 156,273,770 R337H probably benign Het
Pkhd1 T A 1: 20,222,894 Y2834F probably benign Het
Plekhg4 A C 8: 105,379,275 E768A probably damaging Het
Prss37 A T 6: 40,514,975 Y224N probably damaging Het
Ptprs A T 17: 56,458,257 V9E probably damaging Het
Ptprt A G 2: 161,575,778 L926S probably benign Het
Rgl1 G A 1: 152,524,703 T649I possibly damaging Het
Serpinf1 A G 11: 75,416,425 S29P probably damaging Het
Skint6 A T 4: 112,811,520 D1119E probably benign Het
Snw1 T C 12: 87,458,904 K255E probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Tas2r114 A G 6: 131,689,324 I247T probably damaging Het
Tmem110 T A 14: 30,866,682 V122E probably damaging Het
Tmem145 C T 7: 25,308,832 T280M probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Zfp219 T C 14: 52,009,037 H211R probably damaging Het
Zfp42 T C 8: 43,295,735 N243S possibly damaging Het
Zkscan4 T A 13: 21,484,031 S246R probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- TTCCAGAAAGAACACTGCAGCG -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-03-25