Incidental Mutation 'R9298:Kdm5b'
ID 704706
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine (K)-specific demethylase 5B
Synonyms Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock # R9298 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 134560171-134635285 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 134600755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
Predicted Effect probably null
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 72,445,079 A110D probably benign Het
4930407I10Rik A G 15: 82,063,414 E504G probably benign Het
Apbb2 T C 5: 66,451,675 K210E probably benign Het
Arhgef37 G T 18: 61,518,001 A151D probably damaging Het
Btaf1 A G 19: 36,986,714 Y895C probably benign Het
Catsperb A G 12: 101,594,341 I864V possibly damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Col18a1 G A 10: 77,057,370 T1057M probably damaging Het
Col1a2 T A 6: 4,515,260 probably null Het
Col6a4 A G 9: 106,068,335 I860T probably damaging Het
Csmd3 A C 15: 47,753,791 H1000Q Het
Cyp4a29 T A 4: 115,251,198 M373K probably damaging Het
Dnhd1 A G 7: 105,683,966 E215G probably damaging Het
Dopey2 A G 16: 93,800,199 E1972G probably damaging Het
Dusp19 T C 2: 80,617,385 M1T probably null Het
Eif4b A G 15: 102,082,014 T18A possibly damaging Het
Exosc6 G A 8: 111,056,881 A171T probably damaging Het
Fau G A 19: 6,058,267 R6H probably benign Het
Flrt3 T C 2: 140,659,959 D583G probably damaging Het
Fpgt A T 3: 155,087,058 L444* probably null Het
Gm10226 A G 17: 21,691,861 E1G probably null Het
Gm14443 A T 2: 175,170,076 C192* probably null Het
Gm28710 T A 5: 16,791,857 C10* probably null Het
Gm35060 T C 18: 32,460,976 R110G possibly damaging Het
Gm4353 T A 7: 116,083,608 N246I probably benign Het
Igfn1 A G 1: 135,998,589 L41P probably benign Het
Iigp1 T G 18: 60,389,991 D60E probably benign Het
Kcnt2 T A 1: 140,425,297 V248D probably damaging Het
Kctd14 A G 7: 97,458,036 K166R probably benign Het
Kdm4d G A 9: 14,464,040 T174M probably damaging Het
Maz CGCGGCCTCGGCGGCTGGTGCGG CGCGG 7: 127,025,903 probably benign Het
Mkl2 A G 16: 13,384,218 Q115R probably benign Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Olfr1443 T A 19: 12,680,826 C239* probably null Het
Olfr713 A T 7: 107,036,433 I93F probably damaging Het
Olfr93 A T 17: 37,151,681 V97D probably damaging Het
Pigc C T 1: 161,970,463 R5C probably benign Het
Plekhm2 C A 4: 141,629,518 M771I probably benign Het
Pqlc1 T C 18: 80,257,085 L57P probably damaging Het
Runx1 T A 16: 92,644,259 T221S possibly damaging Het
S100pbp A G 4: 129,151,054 Y363H probably damaging Het
Sema5a A G 15: 32,618,894 T523A probably benign Het
Slc38a8 A G 8: 119,486,112 F270S possibly damaging Het
Slc4a1ap T C 5: 31,536,194 S491P probably damaging Het
Slc7a6 T C 8: 106,195,902 V440A probably damaging Het
Sobp A T 10: 43,022,906 C228S probably damaging Het
Svop G A 5: 114,030,170 T456M probably benign Het
Synrg A G 11: 84,009,452 D750G probably damaging Het
Syt14 C A 1: 192,930,636 E336* probably null Het
Tcp11l1 C T 2: 104,698,552 V134I possibly damaging Het
Tle3 T A 9: 61,412,280 H443Q possibly damaging Het
Unc13a C T 8: 71,655,691 R506Q possibly damaging Het
Vmn1r121 A C 7: 21,098,419 V32G probably damaging Het
Wiz A G 17: 32,361,740 F246L probably benign Het
Zfp672 A T 11: 58,329,764 M3K unknown Het
Zfp709 A T 8: 71,890,804 E692D possibly damaging Het
Zglp1 A T 9: 21,066,186 L111Q probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134613926 missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134607768 missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9133:Kdm5b UTSW 1 134602585 missense probably benign
R9423:Kdm5b UTSW 1 134587967 missense possibly damaging 0.85
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTCATTTGAAAGTGTCACCTGG -3'
(R):5'- AATTAGTCCATGTGTGCTAGTGGC -3'

Sequencing Primer
(F):5'- GTGTCACCTGGAAAACAGCTTTTC -3'
(R):5'- AGTGAATTCCAGGCTGACTGC -3'
Posted On 2022-03-25