Incidental Mutation 'R9299:Abca12'
ID 704764
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene Name ATP-binding cassette, sub-family A (ABC1), member 12
Synonyms 4833417A11Rik, 4832428G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9299 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 71242276-71414910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71319883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 588 (N588I)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
AlphaFold E9Q876
Predicted Effect possibly damaging
Transcript: ENSMUST00000087268
AA Change: N588I

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: N588I

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G T 9: 57,256,509 R861S possibly damaging Het
Adamts9 A G 6: 92,796,995 Y1727H probably benign Het
Ahnak G A 19: 9,012,460 probably benign Het
Alad C T 4: 62,511,523 probably null Het
Anapc15-ps C A 10: 95,673,215 D68Y probably damaging Het
Arhgap45 T C 10: 80,026,731 S645P possibly damaging Het
Atp9a A T 2: 168,712,746 M1K probably null Het
B020004C17Rik A T 14: 57,016,773 I118F probably damaging Het
Capn13 T A 17: 73,326,472 probably null Het
Ccdc7a T C 8: 128,889,838 Q928R probably benign Het
Cdc42bpa C A 1: 180,144,508 L1292I probably damaging Het
Clec2e A C 6: 129,095,129 F96V probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cnot1 T C 8: 95,741,820 I1460M probably damaging Het
Cyc1 T C 15: 76,344,306 V45A probably benign Het
Cyp4a10 A G 4: 115,519,750 M104V probably benign Het
Dnhd1 T A 7: 105,720,599 N4410K probably benign Het
Dok4 T A 8: 94,866,841 T106S probably benign Het
Dph1 T A 11: 75,179,796 Q339L possibly damaging Het
Dpy19l3 G T 7: 35,725,327 S187* probably null Het
Eva1a G T 6: 82,092,066 A125S probably damaging Het
Fam155a T C 8: 9,770,156 Y288C probably damaging Het
Fam207a C A 10: 77,515,701 A14S possibly damaging Het
Fam24b T A 7: 131,326,220 Y80F probably benign Het
Frem2 T C 3: 53,656,559 T176A probably benign Het
Gal3st3 A T 19: 5,306,840 N81I probably damaging Het
Gm12888 G A 4: 121,324,847 S16F unknown Het
Gm17018 C A 19: 45,577,570 Q203K probably damaging Het
Hsf5 T A 11: 87,635,944 C481S probably benign Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,728,995 probably benign Het
Ifi211 T A 1: 173,907,722 Q47L probably damaging Het
Il17re A T 6: 113,464,010 M202L probably benign Het
Krtap5-3 T A 7: 142,202,530 H175Q unknown Het
Ksr2 G A 5: 117,747,334 probably null Het
Lrtm1 C T 14: 29,021,757 P61S probably damaging Het
Ltk A T 2: 119,754,240 S487R possibly damaging Het
Mis18bp1 A T 12: 65,138,764 D876E possibly damaging Het
Olfr887 A G 9: 38,085,489 T218A probably benign Het
Paqr7 A G 4: 134,507,000 N56S probably benign Het
Pcdhb22 G T 18: 37,518,832 E118* probably null Het
Pcdhb4 G A 18: 37,309,211 A525T probably benign Het
Pik3cb A G 9: 99,061,791 F653S probably damaging Het
Pla2g4e T A 2: 120,171,723 D617V probably damaging Het
Plekha1 T A 7: 130,909,618 C311S possibly damaging Het
Poteg A G 8: 27,450,259 Y156C probably benign Het
Rev3l T C 10: 39,848,003 S2644P probably damaging Het
Rnf40 T A 7: 127,589,000 S2T probably benign Het
Rrp8 T C 7: 105,734,177 D294G probably damaging Het
Slc6a21 T C 7: 45,287,706 V252A Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
St6galnac6 G T 2: 32,612,333 R78L probably benign Het
Tbce T C 13: 14,019,813 K87R probably benign Het
Thada T C 17: 84,441,777 M589V probably benign Het
Thsd7a A G 6: 12,504,132 F341S Het
Tmem82 A T 4: 141,616,550 C136* probably null Het
Tmprss11a A T 5: 86,422,502 C199* probably null Het
Zbtb48 T C 4: 152,020,690 N505S possibly damaging Het
Zfp385b A T 2: 77,415,771 V304E probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7808:Abca12 UTSW 1 71274634 splice site probably null
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R8053:Abca12 UTSW 1 71349169 nonsense probably null
R8093:Abca12 UTSW 1 71280393 missense probably benign 0.00
R8120:Abca12 UTSW 1 71259381 missense possibly damaging 0.92
R8136:Abca12 UTSW 1 71248397 missense probably benign 0.15
R8155:Abca12 UTSW 1 71291338 missense probably damaging 1.00
R8189:Abca12 UTSW 1 71285726 missense probably damaging 1.00
R8233:Abca12 UTSW 1 71351757 missense probably benign 0.00
R8249:Abca12 UTSW 1 71321812 missense probably benign 0.00
R8255:Abca12 UTSW 1 71319899 missense probably benign 0.13
R8300:Abca12 UTSW 1 71313964 missense possibly damaging 0.77
R8339:Abca12 UTSW 1 71285672 missense probably damaging 1.00
R8490:Abca12 UTSW 1 71284097 missense probably damaging 1.00
R8494:Abca12 UTSW 1 71288662 missense probably benign 0.02
R8527:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8542:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8692:Abca12 UTSW 1 71288715 missense probably damaging 0.96
R8723:Abca12 UTSW 1 71321738 missense probably benign 0.04
R8796:Abca12 UTSW 1 71258089 critical splice donor site probably benign
R8911:Abca12 UTSW 1 71341531 missense probably benign 0.07
R8913:Abca12 UTSW 1 71264813 missense probably damaging 1.00
R8957:Abca12 UTSW 1 71321625 missense possibly damaging 0.90
R9000:Abca12 UTSW 1 71314036 missense probably damaging 1.00
R9137:Abca12 UTSW 1 71259366 missense possibly damaging 0.80
R9228:Abca12 UTSW 1 71293440 missense probably damaging 1.00
R9237:Abca12 UTSW 1 71279398 missense probably damaging 0.97
R9419:Abca12 UTSW 1 71303490 missense possibly damaging 0.81
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Z1176:Abca12 UTSW 1 71284070 missense probably damaging 1.00
Z1177:Abca12 UTSW 1 71276082 missense possibly damaging 0.94
Z1177:Abca12 UTSW 1 71282811 missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71292531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACAGCTTAGTGGTAGGTCC -3'
(R):5'- CGAGGCATGCATGTTCAATAGC -3'

Sequencing Primer
(F):5'- CACACGCATGCATGTGC -3'
(R):5'- GTTAGTGTACCCAAAAACTGTGCC -3'
Posted On 2022-03-25